1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
3 years ago
7

The nurse is providing instruction to the newly delivered client regarding postbirth uterine and vaginal discharge, called lochi

a. Which statement is the most appropriate? A. It is usually greater after cesarean births. B. It should smell like normal menstrual flow unless an infection is present. C. Lochia is similar to a light menstrual period for the first 6 to 12 hours. D. Lochia will usually decrease with ambulation and breastfeeding.
Biology
1 answer:
user100 [1]3 years ago
3 0

<u>Answer:</u>

The statement 'it should smell like normal menstrual flow unless an infection is present' reflects the ability of the kidneys to recover from acute renal failure.

Option: (B)

<u>Explanation:</u>

  • Lochia is the uterine and vaginal discharge occurring at post birth stage in a woman.
  • Certainly, the odour should be same as the Normal Menstrual Fluids.
  • Any difference in the smell or color (like greenish color) of Lochia indicates the presence of infectious organisms such as Chlamydia or Saprophytic which are potential organism for causing infection in women.
You might be interested in
When you go to a salad bar and put mushrooms on your plate you are eating which part of the fungi?
Lilit [14]

The sporophore is the umbrella-shaped body of the mushroom. It is also called the "fruit" of the fungi. It starts out as a small button and grows into stalk and cap. The cap becomes larger and unfolds like an umbrella.

5 0
3 years ago
Read 2 more answers
Which animal lacks an amnion?
deff fn [24]
Mammals do; I'm in my science class
6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
After a caterpillar eats a leaf, It can convert the chemical energy into____ energy to help it build a cocoon.
Xelga [282]
After a caterpillar eats a leaf, it can convert the chemical energy into mechanical energy to help it build a cocoon.
4 0
3 years ago
Most sperm cells die in the vagina when entering the female's body because Most sperm cells die in the vagina when entering the
taurus [48]

Answer:

of the low pH of the vagina.

Explanation:

The pH of the vagina is maintained at highly acidic levels to prevent the germ buildup. The range of vaginal pH is around 3.8 to 4.5. The very low pH of the vagina creates a hostile environment for sperms and most of the sperms are killed as they enter the vagina due to the acidic pH.

Apart from supplementing the sperms with energy, cervical mucus serves to protect the sperms from the hostile conditions of the vagina. The cervical mucus has an alkaline pH at or near the ovulation to protect sperms from acidic pH of the vagina and to facilitate fertilization.

6 0
3 years ago
Other questions:
  • Imagine you work in a lab and your goal is to use the research performed on mice to develop a similar treatment for humans. List
    8·2 answers
  • Which cell moves dust out of the body
    9·1 answer
  • We inhale O₂ and we exhale CO₂. Carbon dioxide is produced __________. a. in the reaction that creates acetyl CoA (coenzyme A) b
    13·1 answer
  • A population of lizards lives in a marsh near the ocean. Members of this population have striped tails that can be yellow, orang
    14·1 answer
  • Can you guys help me with this question please, and thank you!: Why do you think the breastbone of a bird is so much larger than
    11·1 answer
  • Click to fix any plural or possessive errors below. If there is no error, just click
    8·1 answer
  • M protein is produced by
    8·1 answer
  • How are organ systems like a city?
    5·1 answer
  • Why does a psychologist want the results to be statistically significant?
    15·1 answer
  • When two species compete, the niche that each species ultimately occupies is its?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!