1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
swat32
3 years ago
8

Frogs belong to which order? Anura Urodela Caudata Apoda

Biology
1 answer:
vichka [17]3 years ago
8 0

Answer:

Anura

Explanation:

The anura order has some characteristics: they dont have a tail, short but widened body, hind legs very developed and a protactile tongue. So these characteristics represent the common structure of forgs and toads.

You might be interested in
Help me siIIy little people on my siIIy little screen with this siIIy little question ​
qaws [65]

Answer:

5. Gregor Mendel

.........................................

7 0
2 years ago
Read 2 more answers
A species of moth has a 2 varieties of wing color: brown and white. As winter approaches, the trees where the moths live loose t
Morgarella [4.7K]

Assuming that this question makes reference to the survivability of the two moth variations, we can confirm that the brown-colored moth will be better adapted to survive in the winter months.

<h3>Why are the brown moths more likely to survive?</h3>

This has to do with their ability to better hide from predators. As described in the question, their primary predator are birds that hunt them while resting on the tree bark. This means that the white-colored moths will stand out against the dark tree bark and be easier prey for the birds. This will eventually lead to all the moths in the area being brown-colored through the process of natural selection.  

Therefore, we can confirm that the brown-colored moth will be better adapted to survive in the winter months due to their ability to hide from predators.

To learn more about natural selection visit:

brainly.com/question/9830102?referrer=searchResults

5 0
2 years ago
What is carbon dioxide?​
vesna_86 [32]

Answer:

is an acidic colorless gas with a density about 53% higher than that of dry air. Carbon dioxide molecules consist of a carbon atom covalently double bonded to two oxygen atoms.

Explanation:

7 0
3 years ago
Read 2 more answers
PLEASE HELP WILL GIVE 40 POINTS
stepladder [879]

Answer:

Explanation:

Yes this would make sense because of the way turtles are more or less in the grounds of the sand.

No, it shall not. Due to the fact that they can work with cooler and warmer weather when developing.

Yes, no that people are in charge of where turtles would develop, they can change temp at their will, and they know forecasts. This is where they get the upper hand

3 0
3 years ago
Which biome would contain the most biodiversity in deciduous tree species?
dalvyx [7]
D. Tropical rain forest
Hope it helps :)
6 0
4 years ago
Read 2 more answers
Other questions:
  • What shape does the DNA molecule have?
    14·1 answer
  • You find a soldier lying face down. the soldier is conscious and tells you that he thinks he has injured his back. what should y
    14·2 answers
  • Which of these is not a virus?
    9·2 answers
  • Which area of the kidney contains the glomeruli and bowman's capsules?
    5·1 answer
  • A gyre is _____.
    10·1 answer
  • How do u use facilitated diffusion in a sentence?
    7·1 answer
  • The angle of incidence is the angle of light?
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Temperatures on Mars reach as high as 20 °C and fall as low as –140 °C. That temperature is colder than anyplace on Earth. Tempe
    5·2 answers
  • Austin is in a study related to Mary Ainsworth's theory of mother-infant attachment. He is securely attached. Therefore, he show
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!