1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
11

Idk if it would be all of the choices or not

Biology
1 answer:
mafiozo [28]3 years ago
6 0

It would be all if u can pick  that but if not it depends  on what animal  the he question  is talking  about  

You might be interested in
Which of the following might affect gene expression in a complex organism?
daser333 [38]

Answer:

i am researching the answer give me a minute

Explanation:

7 0
3 years ago
Peroxidase is a protein. What is this protein’s function, and how did it get its name?.
Olin [163]

Answer:

Most peroxidases are ferric heme proteins; one notable exception being the glutathione peroxidase, which is a selenium-containing enzyme. They are present in virtually all living species.

Protein has many roles in your body. It helps repair and build your body's tissues, allows metabolic reactions to take place and coordinates bodily functions. In addition to providing your body with a structural framework, proteins also maintain proper pH and fluid balance.

3 0
3 years ago
Please help!!! Will mark brainliest!!!
Law Incorporation [45]

first, third, fourth, second

5 0
3 years ago
Soil that has little to no permeability
skelet666 [1.2K]
Water logged? If the soil does not stick together the soil will seperate and water will have easier access to enter
8 0
3 years ago
Read 2 more answers
Jack has just returned after a walk in the woods. He finds several sticky weed seeds stuck to his jersey with their sharp hooks.
Flura [38]
The reason is to help in seed dispersal. Seed dispersal is the movement or transport of seeds away from the parent plant. Due to the fact that plants have very limited mobility they have to rely upon variety of dispersal; vectors to transport their seeds, including both abiotic and biotic factors. Seed dispersal is important because if seed are not dispersed, many germinating seedlings will grow very close to the parent plant which would result to competition between every one of the seedlings as well as the parent. The competition for essential growth factors such as light, space, water and nutrients. 
6 0
3 years ago
Other questions:
  • A student wants to test the hypothesis that fertilizer improves the growth rate of grass seeds. To test this hypothesis, the stu
    11·2 answers
  • What producers consumer decomposers are for a polar bear?
    7·2 answers
  • Before World War II, Alcoa controlled the supply of bauxite in the United States. Because bauxite is a scarce resource that is v
    12·1 answer
  • he chart below shows the three main types of plant tissues and associated tissues. The chart shows the 3 main types of plant tis
    9·2 answers
  • 1-What is the modern periodic table?
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is in a bacterial cell
    15·2 answers
  • Water concentrates water-soluble human waste products. True or false?
    6·2 answers
  • Which BEST
    5·1 answer
  • What type of bird egg is this btw i live in sc i found it in my backyard my dog was about to step on it
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!