1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
6

Identify the correct statement.

Biology
2 answers:
mihalych1998 [28]3 years ago
8 0

The correct answer is: D. Primary succession occurs in a habitat that has never been colonized by any species before.

Ecological succession can be defined as ae process of change in the species structure of an ecological community over time. There are two types of succession:

• Primary succession- begins in new habitats, uninfluenced by pre-existing communities  

• Secondary succession –formed after a disruption of a pre-existing community.


AlexFokin [52]3 years ago
3 0

Primary succession occurs in a habitat that has never been colonized by any species before.

Ecological succession is the observed process of change in the species structure of an ecological community over time. The time scale can be decades (for example, after a wildfire), or even millions of years after a mass extinction.

Primary succession is one of two types of biological and ecological succession of plant life, occurring in an environment in which new substrate devoid of vegetation and usually lacking soil, such as a lava flow or area left from retreated glacier, is deposited.

Secondary succession is one of the two types of ecological succession of plant life. As opposed to the first, primary succession, secondary succession is a process started by an event that reduces an already established ecosystem to a smaller population of species, and as such secondary succession occurs on preexisting soil whereas primary succession usually occurs in a place lacking soil.

You might be interested in
The nurse in a burn intensive care unit (bicu) is caring for a 3-year-old boy who was burned with scalding hot water. he has bur
iVinArrow [24]
<span>ensuring that the endotracheal tube is secure</span>
6 0
3 years ago
PLEASE HELP
Stolb23 [73]

The bacteria which had mutation became resistant to the antibiotic and survived and keeps on increasing, promoting natural selection.

Explanation:

The bacteria rapidly divide, the chances of mutation in the gene increases manifold.

The strains of bacteria causing tuberculosis and staph infection got mutated at DNA level such that they became resistant to antibiotics when tested those susceptible did not survive. These mutations were not harmful to bacteria and the resultant bacteria survived.

These bacteria which survived and proliferated as the environment was in their favour.

Thus, Darwin's Theory of Natural Selection is acceptable here as it says if a mutation is occurring towards the increase in population, they will be selected ones.

7 0
3 years ago
Which takes longer, primary or secondary succession? explain why
Evgen [1.6K]

Answer:

primary succession takes longer

Explanation:

Primary succession is built from the ground up, whereas secondary succession is built from an already existing civilization.

5 0
3 years ago
Which area of the respiratory system is vascularized with the richest capillary network in the body?​
elena-14-01-66 [18.8K]

Answer:

There are from 200-500 million alveoli (mean diameter = 200 micrometers) in adult human lungs

Explanation:

The epithelial cells of the alveolar septum are markedly thinned and the capillary network immediately beneath the epithelium is the richest in the body.hope this helps you :)

3 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • If an enzyme has a single optimal temperature, then an organism might have difficulty dealing with an environment with wide temp
    12·1 answer
  • Which of the following processes transfers carbon directly from sea water to sea plants?
    10·2 answers
  • A student half a jar with rice and tightens the jars lid. The student wants to use the jar of rice to model particle motion of a
    15·1 answer
  • What is any single living thing called?<br><br> population<br> organism<br> community<br> ecosystem
    10·1 answer
  • Discuss the types of trace elements in organic compounds.
    10·1 answer
  • Hi I need help ???!!!
    13·2 answers
  • You are attempting to synthesize rRNA in a test tube using DNA isolated from mouse cells. In addition to the template DNA, ribon
    7·1 answer
  • the tendency of minerals to break along smooth, flat surfaces is called _____. Streak fracture cleavage luster
    8·2 answers
  • Which of the following is true for a heating curve?
    8·1 answer
  • Why is learning the scientific method as an allied health care professional is important?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!