<span>ensuring that the endotracheal tube is secure</span>
The bacteria which had mutation became resistant to the antibiotic and survived and keeps on increasing, promoting natural selection.
Explanation:
The bacteria rapidly divide, the chances of mutation in the gene increases manifold.
The strains of bacteria causing tuberculosis and staph infection got mutated at DNA level such that they became resistant to antibiotics when tested those susceptible did not survive. These mutations were not harmful to bacteria and the resultant bacteria survived.
These bacteria which survived and proliferated as the environment was in their favour.
Thus, Darwin's Theory of Natural Selection is acceptable here as it says if a mutation is occurring towards the increase in population, they will be selected ones.
Answer:
primary succession takes longer
Explanation:
Primary succession is built from the ground up, whereas secondary succession is built from an already existing civilization.
Answer:
There are from 200-500 million alveoli (mean diameter = 200 micrometers) in adult human lungs
Explanation:
The epithelial cells of the alveolar septum are markedly thinned and the capillary network immediately beneath the epithelium is the richest in the body.hope this helps you :)
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.