1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
6

Identify the correct statement.

Biology
2 answers:
mihalych1998 [28]3 years ago
8 0

The correct answer is: D. Primary succession occurs in a habitat that has never been colonized by any species before.

Ecological succession can be defined as ae process of change in the species structure of an ecological community over time. There are two types of succession:

• Primary succession- begins in new habitats, uninfluenced by pre-existing communities  

• Secondary succession –formed after a disruption of a pre-existing community.


AlexFokin [52]3 years ago
3 0

Primary succession occurs in a habitat that has never been colonized by any species before.

Ecological succession is the observed process of change in the species structure of an ecological community over time. The time scale can be decades (for example, after a wildfire), or even millions of years after a mass extinction.

Primary succession is one of two types of biological and ecological succession of plant life, occurring in an environment in which new substrate devoid of vegetation and usually lacking soil, such as a lava flow or area left from retreated glacier, is deposited.

Secondary succession is one of the two types of ecological succession of plant life. As opposed to the first, primary succession, secondary succession is a process started by an event that reduces an already established ecosystem to a smaller population of species, and as such secondary succession occurs on preexisting soil whereas primary succession usually occurs in a place lacking soil.

You might be interested in
Regional metamorphism tends to make rocks more foliated.<br> True<br><br> False
Dmitry [639]
The correct answer is true
8 0
3 years ago
Label each level of dna packaging in the eukaryotic chromosome with the appropriate term.
Lostsunrise [7]
I assume this photo has the labels you are talking about.

DNA double helix consists of two strands that wind around each other with their nucleotides liked.-> it's the structure number 5
 nucleosome- it's a segment of DNA wound in sequence around eight histones (proteins)- number 2
Histone- proteins with DNA around them, forming the nucleosome- number 4
Tight helical fiber- chromatin <span>coiled very tightly- 3
Cromosome- </span><span>chromatin condensed even tighter forming a X shape.- 1</span>








3 0
3 years ago
Read 2 more answers
Select all of the correct answers.
andrey2020 [161]

Answer: 2, 3, 4,

Explanation:

5 0
3 years ago
Read 2 more answers
How does solid rock become soil?
ra1l [238]

Answer:

A solid rock becomes soil when it breaks down and combines with water, air, and organic matter.

4 0
3 years ago
Read 2 more answers
Children are spending less time outdoors in nature because of which reason(s)
Mrrafil [7]
The two biggest reasons for children spending less time outside are the development of technology and the safety issues. The development of technology brought in our homes countless forms of having fun which is very important to children. The mobile phones, PC's, laptop's, tablets, Sony Play Station, as well as lots of technologically improved toys, made the children stay at home since they have the fun indoors, and not be interested in going outside and in nature. Also the safety issues in lots of parts in the world made the parents to restrict the children to the indoors environment.
4 0
3 years ago
Other questions:
  • Adults often provide indirect feedback about grammar by using __________, which restructures inaccurate speech into correct form
    13·1 answer
  • How are members of archaea different from other prokaryotes?
    14·1 answer
  • What does the Eurasian Boar threaten?
    5·1 answer
  • Three metal spheres are placed next to each other as shown in the picture. A has two times the mass of B. C has one-third the ma
    5·2 answers
  • Complimentary DNA for atgaaccattcagtatgg
    13·1 answer
  • Answer this and i will brai<br>nlist​
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Please help I’m begging you please
    14·2 answers
  • Which of the following best describes the main concept behind Darwin's theory of natural selection?
    9·1 answer
  • Hello people ~
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!