1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
3 years ago
11

Which process changes solar energy into organic matter so that it can be cycled through a food chain?

Biology
1 answer:
Keith_Richards [23]3 years ago
5 0

Answer:photosynthesis

Explanation:

Transfer suns energy into energy for the plant that is a main food source

You might be interested in
Which two parts make up the lithosphere?
Julli [10]
A) The crust and outer part of the mantle make up the lithosphere
6 0
3 years ago
Explain what was the “Society of Orders” and what distinguished each social group
a_sh-v [17]
DescriptionThe term social order can be used in two senses: In the first sense, it refers to a particular system of social structures and institutions
7 0
3 years ago
Red-green color blindness is an x-linked recessive trait in humans. Two people with normal color vision have a son with colorbli
irakobra [83]
Father: XY
Mother: XX’

The father is normal, while the mother is a carrier.
7 0
2 years ago
with examples, describe the following kinds of animals; canivores animals,herbivores​​ animals and omnivores animals​
Semenov [28]
Carnivores (meat eaters): lion, wolf, polar bear. herbivores (plant eaters): cows, beaver, deer. omnivores (both meat and plant eaters): bears, humans, hedgehogs.
5 0
2 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • What does the saying "science is a doing subject" mean?
    5·2 answers
  • What does it mean to be unicellular
    5·1 answer
  • During the life cycle of a seedless plant, a sporophyte releases
    13·2 answers
  • In the 1950s, 40 percent of the U.S. workforce was engaged in manufacturing. By the 2000s, fewer than ________ percent of U.S. w
    11·1 answer
  • What do you think stupor mean
    12·1 answer
  • Which event of the cell cycle takes the longest period of time and why
    14·1 answer
  • Karen is classifying a group of organisms that are enter primary producers or consumers.what is the direct source of energy for
    10·1 answer
  • You are an ecologist studying the life history of a newly discovered animal. You find that it reproduces slowly and has only one
    9·1 answer
  • 1. How would the DNA sequence AATCGA be transcribed to mRNA? A. UUACGU B. TTUGCT C. TTAGCT D. UUAGCU
    6·1 answer
  • Can someone help me with my lab report plz.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!