Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer: Cell differentiation is how generic embryonic cells become specialized cells. This occurs through a process called gene expression. Gene expression occurs because of certain signals in your body, both inside and outside of your cells. Cell differentiation occurs during multiple stages of development.
Answer:
the butterfly, the turtle, and the weird animal that I don't know the name of are all in the first box
Well firstly, alleles are different versions of genes. A dominant allele will show it's trait regardless of if the organism only has one copy of the allele (heterozygous). A recessive allele will show the effect only if two copies of the allele are present (homozygous)
Answer:
Answer is C, the precautionary principle
Explanation:
The precautionary principle is finding a way to cope with likely risk that can occur where scientific understanding is still in process.
It can also be explained as of being conscious when involving in an activity that raises threat of harm to the environment by taking precautionary measures.
