1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Afina-wow [57]
3 years ago
15

List the 5 characteristics of life in order from smallest to largest

Biology
1 answer:
natima [27]3 years ago
8 0

Answer:

The seven characteristics of life include:

responsiveness to the environment;growth and change;ability to reproduce;have a metabolism and breathe;maintain homeostasis;being made of cells; and.passing traits onto offspring.

Explanation:

hopefully that helps you

You might be interested in
Answer this question, right now.
timama [110]
It’s the 3rd option
4 0
4 years ago
Why does petsmart support local adoption agencies and allow them to promote their adoptions in our stores?
vivado [14]
More people becoming pet owners means more product being sold.
6 0
3 years ago
Read 2 more answers
How do you capture energy from the moon?
monitta

Answer:

Twice a day, variations in the Moon's gravitational pull interact with the Earth's gravity and rotation to make tides rise and fall along coastlines and near the mouths of rivers. The kinetic energy in the moving water can be captures and converted into a usable form of energy and water flows through turbines.

Explanation:

hope this helps have a great day and pls mark me as brainlist

5 0
3 years ago
How much of the Earth's animal life exists in the oceans?
DedPeter [7]
60% of animal life live in oceans 

3 0
3 years ago
Read 2 more answers
Which statement describes the movement of objects in the Sun-Earth-Moon system?
Leto [7]

Answer: 3

Explanation:

3 0
3 years ago
Other questions:
  • An example of internalization of behaviors as a result of stress is
    14·1 answer
  • ____ is the most frequently reported infectious disease in the united states.
    9·1 answer
  • Choose the best answer that completes the sentence. 1. Yo ___ de Asuncion.
    12·2 answers
  • Wireless internet is an example of telecommunications. Please select the best answer from the choices provided T F
    10·1 answer
  • What are the standard units of specific gravity?
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • This is the removal of trees and the conversion of forest lands to farmlands, logged areas, or cities.
    11·1 answer
  • Each of the following about cells and the cell cycle is true except
    8·2 answers
  • What kind of pattern do you notice with the structure of DNA
    6·1 answer
  • Describe the importance of the Endomembrane System in the cell in detail..
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!