1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
3 years ago
11

hich statement about warming up before playing sports is NOT true? A. It is necessary to continue to stretch during the game. B.

Getting the blood moving through your muscles prepares them for physical activity. C. Joints can be warmed up through stretching. D. none of the above
Biology
2 answers:
SCORPION-xisa [38]3 years ago
8 0

Answer:

The answer is option D.

Explanation:

The announcements are genuine it's important to keep on extending from amid the diversion. Getting the blood traveling through your muscles sets them up for physical action. Joints can be warmed up through extending. Sports incorporates all types of aggressive physical movement or recreations which, through easygoing or composed cooperation, intend to utilize, keep up or enhance physical capacity and abilities while giving satisfaction to members, and now and again, excitement for observers.

Jobisdone [24]3 years ago
5 0

"D is correct answer." The statements are true it's necessary to continued to stretch from during the game. Getting the blood moving through your muscles prepares them for physical activity. Joints can be warmed up through stretching. "Hope this helps!" "Have a great day!" "Thank you for posting your questions!"

You might be interested in
What factor may influence enzyme activity?
Arada [10]
There are many factors that may influence enzyme activity, such as: temperature, pH, enzyme concentration, substrate concentration, and the presence of inhibitors or activators. It can be temperature because it can be too high above optimal temperature will cause denaturation or too low below optimal temperature will cause a decrease in reaction rates and will eventually halt. It can be pH because enzyme's will denature if raised above or below optimal pH. It can be substrate concentration because of high levels of substrates will increase reaction rates to a point, however when becomes saturated, the reaction rate will become unaffected. Also, it can be inhibitors because of an agent that slows or interferes with a chemical action.

Hope I helped :)
7 0
3 years ago
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
2 years ago
The net primary productivity for a temperate forest was measured as 2,000 mg c/m2/day. the respiratory rate of the community was
Oduvanchick [21]
The general formula for calculating the net value is this
net = gross - deductions
The deduction is the respiratory rate
The net primary productivity is given
Solving for the gross primary productivity
gross = 2000 + 1000
gross = 3000 <span>mg c/m2/day</span>
5 0
3 years ago
What is the path that sperm travels, starting from the seminiferous tubules and ending at the location of fertilization?
Dennis_Churaev [7]
The sperm start travels in the seminiferous tubules of the testes where spermatozoa are born, and then transport to the epididymis which sperm passes to the vas deferens and it ended at the utero-tubal junction where egg fertilizes in the fallopian tubes.
8 0
3 years ago
Which celestial body impacts tides the most
kiruha [24]

Answer:

the sun is almost 390 times farther away from the Earth than is the moon, its high mass still affects the tides. Because the Earth’s surface is not uniform , tides do not follow the same patterns in all places.

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • Explain what you believe may have happened to the ecosystem in year 6 from the Ecosystem Study graph above.
    10·1 answer
  • What is the Dog associated with a Boston terrier? Hint it is a bulldog with round ears. also known as a (frenchie).
    14·2 answers
  • In which of the following soil types will a crab burrow easily: Sand, Silt or Clay. Give reasons for your answer
    11·1 answer
  • What do proteins , carbohydrates, and lipids have in common?
    15·1 answer
  • Assess the effect of the introduction of a nonnative species of tree on the biodiversity of a
    13·1 answer
  • What are the three components of a nucleotide
    13·1 answer
  • Which is the correct Lewis structure for carbon tetrabromide (CBr4), in which a central carbon atom is bound to four atoms of th
    6·1 answer
  • Which choice describes a strategy used to help restore cod populations?
    15·2 answers
  • Why do the polypeptides made in prokaryotes always contain formyl methionine as the first amino acid?
    15·1 answer
  • When a mycelium infiltrates an unexploited source of dead organic matter, what are most likely to appear within the food source
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!