1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
4 years ago
5

When a pendulum is held high and taut and then is released, the pendulum begins to swing. What’s the correct order of the energy

transformations in this example? (PE stands for potential energy.) A. gravitational PE → elastic PE → thermal energy B. gravitational PE → kinetic energy → thermal energy C. kinetic energy → elastic PE → thermal energy D. kinetic energy → gravitational PE → thermal energy E. thermal energy → gravitational PE → kinetic energy
Biology
1 answer:
siniylev [52]4 years ago
6 0
Thermal energy to Gravitational PE to Kinetic energy.
You might be interested in
ompared to eukaryotes, prokaryotes are ________. Compared to eukaryotes, prokaryotes are ________. simpler morphologically and m
Savatey [412]

Answer:

In compare to eukaryotes,prokaryotes are morphologically simpler,more evolutionary primitive,less sensitive to physical environment.

Explanation:

Prokaryotes are unicellular organism which don't possess cell organelle like nucleus,mitochondria,Endoplasmic reticulum,golgi body, etc.

They are the first living organism in the primitive earth and the genetic components are located in the cytoplasm which is enclosed by cell membrane.

prokaryotes contain 3 domains that are Archaea, bacteria and eukarya.

The cytoplasm is enclosed by cell membrane.

Molecular studies have reveal that eukaryotes are evolved from prokaryotes.

Some prokaryotes bear long projection which helps them for locomotion,called as flagellum.This is present in gram positive and gram negative bacteria.

7 0
3 years ago
Euglenoid chloroplasts are surrounded by ______ membranes.
bagirrra123 [75]
Euglenoid chloroplasts are surrounded by nuclear membrane
7 0
3 years ago
Read 2 more answers
A gallon of olive oil sitting on a high shelf is likely to have:
valentinak56 [21]
B. Because it has potential energy and it’s not kinetic energy because that’s what it would have if that container fell.
8 0
3 years ago
Read 2 more answers
Where did the carbon in living hings come
agasfer [191]
<span>It was made in stars that lived before the solar system formed.

Hope this helps!

-Payshence xoxo</span>
3 0
3 years ago
What molecules are required for the Calvin cycle? (3 answers)
Ber [7]

Answer:After the energy from the sun is converted and packaged into ATP and NADPH, the cell has the fuel needed to build food in the form of carbohydrate molecules. The carbohydrate molecules made will have a backbone of carbon atoms. Where does the carbon come from? The carbon atoms used to build carbohydrate molecules comes from carbon dioxide, the gas that animals exhale with each breath. The Calvin cycle is the term used for the reactions of photosynthesis that use the energy stored by the light-dependent reactions to form glucose and other carbohydrate molecules.

Explanation:The Interworkings of the Calvin Cycle

In plants, carbon dioxide (CO2) enters the chloroplast through the stomata and diffuses into the stroma of the chloroplast—the site of the Calvin cycle reactions where sugar is synthesized. The reactions are named after the scientist who discovered them, and reference the fact that the reactions function as a cycle. Others call it the Calvin-Benson cycle to include the name of another scientist involved in its discovery (Figure 5.14).

This illustration shows that ATP and NADPH produced in the light reactions are used in the Calvin cycle to make sugar.

3 0
2 years ago
Read 2 more answers
Other questions:
  • What is the differences in stuctures for lymphocytes and phagocytes
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What evidence did Galileo use to support Copernicus’s model and disprove Aristotle and Ptolemy? Select two options.
    9·2 answers
  • The part of an atom that would be found outside the nucleus is the _______. A. electron B. positron C. neutron D. proton
    10·2 answers
  • The majority of non-mammalian or non-avian animals are ectotherms and rely on the environment as their heat source. Which of the
    6·1 answer
  • Bill Barkley compares his checkbook register, cancelled checks, and bank statement which shows a balance of $500. He finds two o
    6·1 answer
  • How do we get the glucose we need to power our cells? a. Breathing b. Exercising c. Eating d. Drinking water
    5·1 answer
  • Prokaryotic cells do not contain many of the organelles that eukaryotic cells have. Prokaryotic cells do have a primitive form o
    12·1 answer
  • You classified organisms based on anatomical structure and development. Scientists also use DNA to classify organisms. Consideri
    5·1 answer
  • From the graph, how can water's high specific heat capacity be observed? A) The ocean surface temperature and the land surface t
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!