1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
atroni [7]
3 years ago
14

PLEASE ANSWER

Biology
2 answers:
VladimirAG [237]3 years ago
7 0

B Would Be The Correct Answer .

Alexandra [31]3 years ago
3 0

Eukaryotic cells  are cells that have a nuclear envelope, cytoplasmic organelles, and a cytoskeleton.

Prokaryotic cells  are cells lacking a nuclear envelope, cytoplasmic organelles, and a cytoskeleton (primarily bacteria).

Also Eukaryotic cells have a nucleus in which the genetic material is separated from the cytoplasm.

Also Prokaryotic cells are generally smaller and simpler than eukaryotic cells; in addition to the absence of a nucleus, their genomes are less complex and they do not contain cytoplasmic organelles or a cytoskeleton

So the correct answer would be B.

Hope I helped.

You might be interested in
what system is made up of the nose, pharynx, trachea, lungs, bronchi, and alveoli. circulatory endocrine immune respiratory
Yuri [45]
The system that is made up of those is called the Respiratory System
4 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
What is the relationship between genes and chromosomes?
ANTONII [103]
I'm pretty sure the answer would be A. Chromosomes contain one or more genes.
7 0
4 years ago
Read 2 more answers
What is the purpose of cells?
Nezavi [6.7K]

Explanation:

Hey there!

  • The main function of cell is to <u>make</u><u> </u><u>a</u><u> </u><u>life</u><u> </u><u>possible</u><u> </u><u>in</u><u> </u><u>the</u><u> </u><u>universe</u><u> </u><u>by</u><u> </u><u>performing</u><u> </u><u>various</u><u> </u><u>type</u><u> </u><u>of</u><u> </u><u>vital</u><u> </u><u>activities</u><u>. </u>
  • Various type of cell performes various type of activities. The same type of cell combine together to form tissue. Similarly, similar tissue combine and form organ. Now, Organs combinly form form a system and all system form a whole body. They combinly perform task for sustaining life in the universe.
  • <u>Cancer</u><u> </u>are caused mainly due to abnormal growth of cells. It shows various type of symptoms. Such as;
  1. The wounds donot heal faster, instead it may be worse.
  2. Unwanted bleeding may occur from nose, mouth, or other parts.
  3. You may see lump in some parts of body.(Thickness of skin).
  4. They also may have problem of hair loss in more amount.

<em><u>Hope</u></em><em><u> </u></em><em><u>it helps</u></em><em><u>.</u></em><em><u>.</u></em><em><u>.</u></em>

5 0
3 years ago
What effect does climate have on parent material?
Alinara [238K]
Climat effects many things but what do you mean parent material
8 0
3 years ago
Other questions:
  • To transform bacteria with plasmids, technicians first make the bacteria competent (capable of taking up DNA) by placing them in
    12·1 answer
  • Why does meosis produce cell with fewer chormasomes
    9·1 answer
  • How many hydrogen bonds are found between a-t
    14·1 answer
  • How might a scientist display data on the territories of different groups of chimpanzees? What would this be an example of?
    8·1 answer
  • What is _ is a natural difference between members of species
    10·1 answer
  • true or false compiling data into a table is not a useful method for distinguishing between contrasting observations​
    8·2 answers
  • What are examples of Unicellular things in everyday life
    8·1 answer
  • A/An _______ map shows the types of rock and/or sediment present in a particular region.
    9·2 answers
  • Ethical dilemmas raised by dna technology and knowledge of the human genome include?
    8·1 answer
  • Astrocytes carrying the superoxide dismutase 1 (SOD1G93A) mutation induce wild-type motor neuron degeneration in vivo.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!