1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
12

The part of an ecosystem where a species lives is their

Biology
1 answer:
chubhunter [2.5K]3 years ago
7 0
 where a species lives is their habitat.
You might be interested in
Members of the phylum ciliophora use
DedPeter [7]

Ciliate, or ciliophoran, any member of the protozoan phylum Ciliophora, of which there are some 8,000 species; ciliates are generally considered the most evolved and complex of protozoans. Ciliates are single-celled organisms that, at some stage in their life cycle, possess cilia, short hairlike organelles used for locomotion and food gathering.

5 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
What would happen if the dorsal root of a spinal nerve were completely transected?
AnnZ [28]

There would be loss of sensory function

The dorsal root of spinal nerve is the part of the peripheral nervous system that picks up sensory signals/ information and transmits the signal through the nerve to the brain. If the root is damaged or transected, the brain will no longer receive sensory messages from that nerve, which means that the patient will have loss of sensation in that area.






6 0
3 years ago
What factor are necessary for natural selection to occur?
sergeinik [125]

1.Reproduction

2.Heredity

3.Variation in fitness or organism

4.variation in individual characters among members of the population

8 0
3 years ago
I don’t know all of the answers for my biology homework
Naily [24]

are you kidding me? I'm only answering one because I need more points for stupid questions I have on problems with my body. 29 is DNA and RNA

3 0
3 years ago
Other questions:
  • Chromosomes store genetic information true or false
    15·2 answers
  • Make a claim that answers the scientific question
    12·2 answers
  • Complete the sentence: Air above the equator is heated more than at any other place on Earth because solar rays strike the equat
    11·1 answer
  • What is incomplete dominance?
    5·1 answer
  • The stem of a plant _____.
    14·2 answers
  • The polymer that forms the various enzymes in our bodies is ______.
    11·1 answer
  • What is karotyping and how is it used in science / medical field??
    10·1 answer
  • Cual es la funcion de la respiracion
    14·1 answer
  • How do cells use the ATP cycle shown in the figure above?
    14·1 answer
  • Why do we add gel loading buffer at the end of the digestion
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!