1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
15

Match these cell cycle checkpoints to their role in genome integrity is the dna replicated with out damage?

Biology
1 answer:
Andru [333]3 years ago
7 0
Match these cell cycle checkpoints to their role in genome integrity:Is the DNA replicated with out damage?Are the chromosomes lined up correctly attached to the mitotic spindle?
Does the cell have a enough nutrients, proteins and growth factors?Is the cellular DNA badly damaged during the replication process?

G2 
Is the DNA replicated with out damage?

M
Are the chromosomes lined up correctly attached to the mitotic spindle?

G1/S 
Does the cell have a enough nutrients, proteins and growth factors?

Intra-S (during S-phase)
Is the cellular DNA badly damaged during the replication process?

You might be interested in
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Consider two forests: one is an undisturbed old-growth forest, while the other has recently experienced a high intensity wildfir
jekas [21]

Answer:

A. the burned forest because the disturbance has removed competitors and made more resources available

Explanation:

An exponential growth refers to a rapid growth rate within a specific time limit.

Competition for limited resources by different plant species occur within an ecosystem, a form of relationship that limits the growth of all the parties involves.

When a disturbance regime within a forest removes some of the plant species within it, other species grows rapidly as a result of more availability of resources (than usual) due to reduced competition.

Hence, the correct option is A.

4 0
3 years ago
How do the thin membranes of the alveoli in the lungs allow the lung to function?
tankabanditka [31]
Answer:
B

Explanation:
Thin membrane allow effective gaseous exchange to occur as the respiratory gasses can penetrate the membrane easily
6 0
3 years ago
Why does the moon rise and set 50 minutes later each night.
baherus [9]

Answer:

The Moon rises and sets every day, like the Sun. ... But the Moon is orbiting around the Earth; every day, it moves eastwards (further left from the Sun) by about 12 degrees. This means that it increasingly lags behind the Sun, by about 50 minutes a day. i hope this helps

Explanation:

8 0
3 years ago
Angiosperm ______.
Talja [164]

Answer:<u><em>nonvascular</em></u>

a plant that has flowers and produces seeds enclosed within a carpel. The angiosperms are a large group and include herbaceous plants, shrubs, grasses, and most trees.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which therapeutic approach is most effective in treating difficulties such as premature ejaculation and erectile difficulties?
    15·1 answer
  • DNA BASE SEQUENCE : ATGATCTCGTAA<br> What is the Resulting mRNA sequence??
    11·1 answer
  • Do cells use energy to get rid of salt or water?
    13·1 answer
  • Exercise results in skeletal muscles compressing veins which encourages blood to return to the heart. In this scenario, which of
    8·1 answer
  • How does the background rate of extinction differ from mass extinctions?
    13·1 answer
  • The current Acceptable Macronutrient Distribution Range (AMDR) for saturated fat is __________ percent of the daily caloric inta
    10·1 answer
  • Differential survival and reproduction is best described by which term?
    11·2 answers
  • Loni makes a diagram to help organize what she has learned about the gas laws.
    8·1 answer
  • Please HELP ME ASAP I WILL GIVE YOU BRAINLEST Question 4 (3 points)
    11·1 answer
  • What does newton's first law of motion benefits
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!