1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnyKZ [126]
3 years ago
14

LESSON 5: bio 1A Cells and homeostasis

Biology
2 answers:
Nana76 [90]3 years ago
6 0
<h3>Answer#1 </h3><h2>(C) Wastes, nutrients and water </h2><h3>Explanation:  </h3>

It is the replacement of a section or one part of an insect or a different segmented animal by a composition composed of a different section, primarily through mutation. In evolutionary developmental biology, homeosis is the transmutation of an individual organ into another, resulting from a mutation or mis expression of several developmentally important genes, especially homeotic genes.

<h3>Answer#2 </h3><h2>(A) It dies </h2>

Unicellular organisms are the once which carries only one cell. Homeostasis is the state organism requires to operate at highest productivity. If an organism does not preserve homeostasis, the organism will not be capable to perform at full ability. Living things react to stimuli that happen inside them.  


<h3> Answer#3</h3><h2>(A) Both unicellular and multi-cellular organisms are at risk of having too much water entering their cells if they are exposed to water containing no salts.</h2>

The amount of salt in the center of the living cells is greater and so the water will flow from the medium which has no salt to the interior of the cell where there is salt, this process is called as osmosis. And as a result to this salt content is higher in both the cellular organism.


<h3>Answer#4 </h3><h2>(C) They are specialized in function and work cooperatively with one another. </h2>

Cells are categorized according to their function so that they can interact with one another and work together. Similarly, the once that does not possess same functions are kept apart so that living process does not pauses or stops.  


Kobotan [32]3 years ago
3 0
Is this actually a question? Lol.
You might be interested in
People with heart problems often have trouble breathing. why would this happen?
-BARSIC- [3]
The pumping of the heart is tied to the respiratory system

3 0
3 years ago
Read 2 more answers
How is carrying capacity limited by resource availability? A. The number of resources in an ecosystem determines how many organi
stich3 [128]

Answer:

A

Explanation:

4 0
3 years ago
What skill is a scientist using when she listens to the sounds that an elephant makes?
Oliga [24]
They make a maaaaaa sound
7 0
3 years ago
Explain the circumstances when a recessive trait will be expressed.
Sophie [7]

Answer:

Mark me as brain list plz

Explanation:

When a trait is recessive, an individual must have two copies of a recessive allele to express the trait. Recessive alleles are denoted by a lowercase letter (a versus A).

6 0
2 years ago
Read 2 more answers
The continents began to drift apart by the end of the
Eduardwww [97]
Continental drift happened around the Jurassic period, 175 million years ago.

<span />
3 0
3 years ago
Other questions:
  • HEEEEEEEELLLLLLLLLLLLLPPPPPPPPP !!!!!!!!!!!!!!! Which of the following are disadvantages of the Aristotelian classification syst
    14·1 answer
  • In the carbon cycle, decomposition is the breakdown of a substance into simpler substances. What is the name for the process of
    11·2 answers
  • The shape of a pyramid is primarily determined by what demographic shape?
    11·1 answer
  • Which cellular process is described by the chemical equation below?
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Fungal asexual spores Select one: a. are used to identify fungi. b. produce offspring with different combinations of genes from
    13·2 answers
  • The stem of a plant is experiencing phototropism. Which statement correctly describes the plant's response?
    14·2 answers
  • What term describes a new community replacing an existing community?
    14·1 answer
  • What is the sequence of amino acids formed from this gene?
    6·1 answer
  • Opción que contiene los elementos que favorecieron el asentamiento de las culturas mesoamericanas​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!