1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddik [55]
3 years ago
8

6

Biology
2 answers:
kolezko [41]3 years ago
7 0

Answer:A genetic code shared by diverse organisms provides important evidence for the common origin of life on Earth. That is, the many species on Earth today likely evolved from an ancestral organism in which the genetic code was already present.

Explanation:

--as a result of shared common ancestry

--through mistakes during DNA copying

through advancements in molecular biology

--as a result of an extensive DNA analysis

Tasya [4]3 years ago
3 0

Answer:

DNA changes occur primarily because of natural errors that occur during the DNA replication process. They also can happen when one or more environmental factors act on the DNA. Jul 24 2019

Explanation:

You might be interested in
Legend has it that there was a less famous geneticist in the 1800s
NNADVOKAT [17]

Answer:

Few crosses

The complexity of cat genetics

Crosses not controlled by the researcher

Explanation:

The purpose of this question is to determine why  Megor Grendel is less famous than that of Gregor Mendel.

Gregor Mendel examined pea plants, which have a number of benefits for deducing genetic rules, including:

  • The researcher has total control over the crosses.
  • Because the peas have both self and cross-fertilization, it is possible to alter the crosses in the simplest way possible.
  • Pea plants may be examined for a greater series of generations than cats or other animals.
  • Because plant genetics is not overly complicated, several traits may be investigated at the same period.

As a result, the primary factors why Megor Grendel's experiments are not well-known:

  • The presence of only a few crossings: It is impossible to establish a genetic theory with such a small number of crossings on the test subject of the organism.
  • Cat genetics is too complicated therefore, the fur gene color on the X-chromosome, a characteristics mosaic inheritance. As a result, It is much too complicated to deduce an inheritance pattern.
  • Crossings that the researcher cannot fully control. Unlike plants, crosses in animals cannot be totally controlled by the researcher.

As a result, it is impossible to draw any conclusions from them.

3 0
3 years ago
Which is not a cause of noninfectious diseases?
Varvara68 [4.7K]
The answer is A, and this is true because trauma can not be transmitted or caught by humans or animals but a virus , faulty nutrition & congenital defects can. hope this helps :)
4 0
3 years ago
Read 2 more answers
In vertebrate animals, the same organ in different species often have different structures. For example, the heart of a fish has
barxatty [35]
B reproductive differences I hope this helps!
6 0
3 years ago
Read 2 more answers
What is the connection between the liver (organ), UV radiation (sunlight), and bone tissue? I need something with more informati
joja [24]
The connection between them is Vitamin D.

Vitamin D can be obtained from food and supplements, or synthesized by our bodies when we receive UV radiation in our skin, which is our major source. However, this vitamin comes <span>inactivated</span> and the only way to activate it is through enzymatic conversion (hydroxylation) in the liver and later in the kidneys.

 This vitamin is necessary in the intestines because allows calcium and phosphorus to be observed, leading to normal growth and development of bones and teeth. Without enough vit D, bones become fragile, causing osteoporosis.

5 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Describe about development of flat bone.
    13·2 answers
  • Diversity is an expression of the total number of organisms in a biological community.
    5·1 answer
  • What is a major source of human generated pollution that enters the oceans and that can result in a loss of biodiversity?
    6·2 answers
  • What happens when you move the microscope stage in different directions?
    5·2 answers
  • Read the information on predators. Then answer the questions provided. Predator-Prey Relationships Which organisms are considere
    7·2 answers
  • What can be define Axon term?
    8·2 answers
  • Who proposed that Missouri be allowed to enter the union as a slave state if no more slaves were brought into Missouri after tha
    10·1 answer
  • what is the difference between the greatest distance and the least distance ridden on one fifth of a mile to one mile
    9·1 answer
  • According to the etext reading for Marine Biomes, which of the following are reasons
    10·1 answer
  • A DNA strand has the following bases: A G A C C A T A . What are the bases on its complementary RNA strand ?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!