1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
max2010maxim [7]
3 years ago
8

4. Coevolution is when two species that have close ecological interactions evolve jointly over time.

Biology
2 answers:
Akimi4 [234]3 years ago
8 0

No. In biology, coevolution occurs when changes in at least two species' genetic compositions reciprocally affect each other’s evolution.

aniked [119]3 years ago
3 0

Answer:

No, coevolution never occurs when two species that have close ecological interactions evolve jointly over time.

Explanation:

The coevolution is the process in which two species evolves together. These species affects each other. In coevolution, species shares close ecological interactions.

The ecological relationship which shows coevolution are parasitism and competition, mutualism. In parasitism one species is negatively affected and the parasite gains the benefit. In competition both species harm each other.

In mutualism both species gains the benefit.

You might be interested in
Power is the blank at which work is done?<br> Someone help fill in the answer plz
Elodia [21]
Power is the rate at which work is done.

Hope this helps!
6 0
3 years ago
Read 2 more answers
Which specific subdivision of the nervous system calms the body after strenuous physical activity?
7nadin3 [17]
The answer to this question would be: parasympathetic division

Parasympathetic nervous is part of the autonomous nervous system. In the autonomous nervous system, the sympathetic system is used when you enter the "fight or flight" mode. In this case, the body will be prepared to be able to take a decision as quickly as possible in a strenuous state. The nervous also cause an increase in the heart and breathing rate to increase body capability.
Parasympathetic is the opposite of it which was activated to calm the body so it can maintain the normal body function.
8 0
3 years ago
Describe how energy and matter move through the food web and carbon cycle 
Scilla [17]
Photosynthetis, burning of fossil fuels, plant respiration.
3 0
3 years ago
Read 2 more answers
I NEED HELP PLEASE <br> How many moles of water are produced if you harvested 182 g of water
shusha [124]

Answer:

10.11 moles

Explanation:

formula

n=m/Mr

8 0
2 years ago
Which of the following is a characteristic of alcoholic fermentation?
Andrew [12]
The correct answer choice is D. Production of ethanol
5 0
3 years ago
Read 2 more answers
Other questions:
  • The adding of egg and sperm is the process known as
    5·1 answer
  • Help give me the right amdwer
    13·1 answer
  • The crystal size of an igneous rock is described as its
    12·2 answers
  • How does the ocean help to maintain moderate temperatures across the globe? by increasing the wind speed around the globe, by be
    15·1 answer
  • The object whose motion is shown on the following graph is _____. speeding up slowing down standing still holding at a constant
    12·1 answer
  • Alfred Wegener's theory about earth's past included a supercontinent made up of all the continents put together. What was the na
    5·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Ez PTS!! for fun just find a random wording on a magazine speech or whatever and make a poem
    13·1 answer
  • Explanation chemosynthesis and give an example
    5·1 answer
  • How do the specific characteristics of carbon, hydrogen and oxygen enable the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!