1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
11

Please answer quickly!!!!!!!!!

Biology
1 answer:
natka813 [3]3 years ago
3 0

Answer:

They both have cell wall

You might be interested in
What commonly consumed food originates from the amazon rainforest?.
allochka39001 [22]

Answer: There are a bunch, but chocolate/cacao is a main one!

Explanation: Hope this helped :)

3 0
2 years ago
According to the octet rule, if an atom has fewer than 8 electrons in the outer most energy level, what is likely to happen?
Sliva [168]

According to the octet rule, If an atom has fewer than 8 electrons in the outer most energy level, it will react with other nearby atoms to give, receive or share electrons until it has a full outer shell. Option D.

<h3>What is the octet rule?</h3>

The octet rule is a theory stated by Lewis (1917) and is used to explain how atoms are combined.

The theory explains how atoms from different elements tend to complete their outer energy layer with 8 electrons to reach a stable electronic configuration.

The ions of different chemical elements complete their last energy levels when combined with other atoms.

Atoms can either gain or share electrons with other atoms to compose the molecule,

  • High electronegativity elements gain electrons until they get to complete the octet.
  • Low electronegativity elements lose or share electrons to get to the octet.

In this way, the rule explains how atoms form bonds to create a molecule.

The rule is used to predict the behavior of several substances according to their electronic configuration.

Among the options, the correct one is option D. <em>if an </em><em>atom</em><em> has fewer than 8 </em><em>electrons</em><em> in the outer most</em><em> energy level</em><em>, it will react with other nearby atoms to give, receive or share electrons until it has a </em><em>full outer shell.</em>

<em />

You can learn more about the octet rule at

brainly.com/question/1202688

brainly.com/question/865531

#SPJ1

8 0
2 years ago
When people exercise, their body cells build up more waste quickly. Which two body systems work
Sliva [168]
Respiratory and circulatory systems work hand in hand to expel wastes. respiratory system removes CO2 and the circulatory uses the blood as a medium to move excess salts and water from source to sink.
7 0
3 years ago
Share diagrams from your notes of a labeled plant and animal cell
baherus [9]
If you have any questions about these cells ask me

8 0
3 years ago
What is the most likely reason the population of these butterflies has been declining?
Gala2k [10]
I dunno i i i i i i i i i i i i i i i i i i i i dunno

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which sentence about particles in matter is true?
    5·2 answers
  • A hypothetical three-step metabolic pathway consists of the intermediates W, X, Y, and Z, and the enzymes that catalyze the reac
    13·1 answer
  • What is a mutation?
    15·1 answer
  • Question: How did the Mesosaurus fossils on the South American Plate and African Plate get so far
    13·1 answer
  • Vitamin C helps with collagen synthesis and act as antioxidant. True or False?
    11·1 answer
  • What is the major source of energy for the Earth?
    12·1 answer
  • 3. What is the original source of energy for all fossil fuels?
    6·2 answers
  • What is fibre and it types​
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Help!!!!!!!!!! Nowww! I’ll mark YOU BRAINLY!!
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!