1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
13

How does the shape of a plant cell differ from that of an animal cell?

Biology
2 answers:
dezoksy [38]3 years ago
7 0
A plant cell has a couple more features than a animal cell.
ra1l [238]3 years ago
4 0
The shape of a plant cell is a square, while the shape of an animal cell is circular. Hope this helps! :)
You might be interested in
Brainliest involved!! Help please and thank you
Alecsey [184]

Answer

D

Glycolysis is the process, which occurs in cytoplasm of cell. This is the process which involves the breakdown of glucose to pyruvate. Citric acid cycle and beta oxidation of fatty acids occurs in the mitochondrial matrix, electron transport chain and  oxidative phosphorylation occurs in the oxysomes. So, it is NOT a.

It has to be 2 and 3, which is D.

Explanation:

5 0
2 years ago
Read 2 more answers
PLEASE HELP QUICK!!!
VMariaS [17]

Answer:

its the 3rd one

Explanation:

chmical wheathering one

4 0
3 years ago
which is a goal of the human genome project? a)to identify the 3 billion genes that comprise the human genome b)to sequence the
hodyreva [135]

Answer:

The most appropriate answer would be a)to identify the 3 billion genes that comprise the human genome.

Human genome project was the collaborative international project with the common objective of sequencing the whole genome of a human being and to identify and map all the genes present in the genome.

The project was completed, by sequencing approximately 3 billions base pairs of the human genome.

Later, it was found that only around 20000 protein-coding genes were present in the human genome which was very as compared to the previous estimations (1 million to 50000).

6 0
3 years ago
Read 2 more answers
Help me please <br><br><br><br><br> Asap
PIT_PIT [208]
Judging by the hair, you can find it's origin and as long as if you had a group of people to be looking at you can match the color and DNA of each person's hair to the hair you found when you were doing your forensics were at said crime scene.  I don't necessarily know the processes that were taught but the <em>investigation</em> wouldn't be too difficult.
8 0
3 years ago
HELP 80 POINTS IF U ANSWER + BRAINLIST!!!
kumpel [21]

Answer:

Once exposed, they are weathered, both physically (by mechanical breaking of the rock) and chemically (by weathering of the minerals), and the weathering products — mostly small rock and mineral fragments — are eroded, transported, and then deposited as sediments. Therefore, the model should show signs of deterioration and subduction.

Explanation:

I'm not sure if this is on a quiz or test, but this is what I would put down. No need to mark me brainliest, thanks anyway! :)

8 0
2 years ago
Other questions:
  • A bakery makes 640 muffins every day. Which equation shows how to find the number of muffins the bakery makes in a week?
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Unscramble!!
    14·2 answers
  • The ecological relationship between organisms where one benefits and the other is not affected
    11·1 answer
  • Effect of water pollution​
    11·1 answer
  • PLEASE HELP! 50 POINTS AND BRAINLIEST!
    10·1 answer
  • All living things are classified into kingdoms based on specific characteristics. which of the following are only characteristic
    11·1 answer
  • I need help plz and thank you and asp this is for science
    8·1 answer
  • 5. What would our planet be like without plants?​
    14·2 answers
  • parietal serosa serous membrane parietal pleura parietal pericardium visceral serosa Visceral pleura visceral peritoneum serous
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!