1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
3 years ago
8

Why does it take so long for plants to grow

Biology
1 answer:
ale4655 [162]3 years ago
6 0
Because plants go through a cycle(the cycle is seed, seedling, plant, flower and tree.) and it takes time for the plant food, water, and nutrients to go though the plant.
You might be interested in
It is crucial that the process of mitosis is error free. This is because otherwise healthy cells can
kherson [118]

The correct answer is that it becomes cancer cells.  

Mitosis refers to the kind of cell differentiation, which leads to the formation of two daughter cells, and each comprising the same type and amount of chromosomes as the parent nucleus, generally of ordinary tissue growth.  

The process of mitosis should be error free as otherwise healthy cells can turn into cancer cells. Cancer is basically a disorder of mitosis, in this case, the usual checkpoints, which are monitoring mitosis are overridden or ignored by the cancer cells.  

Cancer initiates when a single cell is converted or transformed into a normal cell to a cancer cell and is generally taking place due to a modification in function of one of many genes, which usually work to monitor growth, like p53 gene or tumor suppressor gene.  


6 0
3 years ago
Read 2 more answers
Match each scenario to its related biomolecules. Jack is eating a diet that will help him build muscle, so he eats a diet high i
Stells [14]

The options for this question are as follows:

A. Nucleic acids

B. Carbohydrates

C. Fats

D. Proteins

Now the correct answers of the match are as follows:

Jack is eating a diet that will help him build muscle, so he eats a diet high in this. <u>D. Proteins</u>

Explanation: Proteins help to build up the muscles. That's why people who want to do body-building, eat protein rich foods, like chicken, eggs, soy, etc.

Before a race, Ruth drinks a beverage full of this biomolecule to get energy. <u>B. Carbohydrate </u>

Explanation: This biomolecule provides instant energy to our body. For example, glucose is consumed before race, as dissolves quickly in our blood and provides instant energy. Glucose is an example of simplest carbohydrate.

These molecules in olive oil will help Ruth’s body store long-term energy. <u>C. Fats </u>

Explanation: Fats are the kind of biomolecule which is stored in our body in the adipose tissues. Also, when glucose is all used up by our body cells, the body starts to get energy from this stored fat.

Elizabeth has been advised to go for genetic screening to detect any abnormalities in her unborn child. <u>A. Nucleic acids </u>

Explanation: Every cell of our body has DNA, and it contains all the genetic information about the whole body. DNA is a kind of nucleic acid. If Elizabeth is going for test of the abnormality, it means she is going to test for the DNA of her child.

6 0
3 years ago
How many glucose molecules can be formed by 6 molecules of carbon
Hoochie [10]

Answer:

1

Explanation:

"Six carbon dioxide molecules (CO2) are required to create one glucose molecule (C6H12O6) because carbon dioxide has one carbon per molecule, while glucose molecules have six carbons."

3 0
3 years ago
Suppose you are studying coyotes and wolves, and you determine that wolves are experiencing a reduction in their population that
PolarNik [594]
<span>If one determines that wolves are experiencing a reduction in their population that can be attributed to a virus the coyotes carry that is more harmful in wolves. this is an example of apparent competition.</span>
4 0
3 years ago
Put yourself in the role of each of the following people:
Sergeu [11.5K]

Answer:

idc

Explanation:

i dont understand bc i dont have this class

4 0
3 years ago
Other questions:
  • How placenta is design to provide nutrition to developing embroy
    13·1 answer
  • Which organelle appears as a stack of membranes?
    15·2 answers
  • How does rough ER from smooth ER?
    9·1 answer
  • What is the importance of capillary fluid exchange?
    8·1 answer
  • If the greek root tithenai means to put or place, what does synthesis mean?
    12·2 answers
  • What will determine a plants height, environment, genetics, or both? Explain your answer
    14·1 answer
  • Why does salad become soggy and wilted when the dressing has been on it for a while? Explain in terms of osmosis.
    11·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • PLEASE HELP!! Will mark brainliest
    10·1 answer
  • HELPPPP
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!