1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksley [76]
3 years ago
6

Do you think GM foods should be labeled in food stores in the United States so that you can distinguish them from conventional f

oods? Explain your reasoning and use examples to support your answer
Biology
1 answer:
Oksanka [162]3 years ago
4 0
GM foods should be labeled in food stores. If, for example, someone wanted to buy a GM Apple, which could be enriched in chemicals, that should be labeled different than a regular apple. What if someone was allergic to some of the modifications in that apple. If there was a label on that apple, that person would not get a allergic reaction. That is why GM products should be labeled.

H0P3 It H3LPS :)

You might be interested in
Two students decide to repeat the Hershey and Chase experiment with modifications. They decide to label the nitrogen of the DNA,
Ipatiy [6.2K]

Answer:

radioactivity will not be able to tell the difference between the DNA and proteins

Explanation:

It seems that the experiment will fail to show what Hershey and Chase showed because they modify some of the aspects. These modifications will cause changes to the results, the main one being that radioactivity will not be able to tell the difference between the DNA and proteins. This is because Amino Acids are proteins that also contain nitrogen atoms, thus labeling the nitrogen would include all DNA and proteins. This being the main reason why Hershey and Chase decided to label the DNA instead.

4 0
3 years ago
This is the intensity of light; the amount of light seen.
kari74 [83]

Answer:

ION KNOW

Explanation:

SHIIIIIIIIIIIIIIIIIIIIID

3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Which could be a primary source of energy in a food web?
Deffense [45]

Answer:

The plant which I think it says clover i can see

Explanation:

plants are primary sources of energy because it makes it own food and doesn't take form other animals.

6 0
2 years ago
The manager of a book store surveys people who buy mystery novels to see if the store should expand its hours. What is the popul
kkurt [141]

Answer:

The population is people who buy mystery novels at that specific book store.

6 0
3 years ago
Other questions:
  • What would most likely happen to cells places in fresh water
    9·2 answers
  • Which factors provide the basis for the differences observed in the major land biomes on Earth?
    6·2 answers
  • I need help with the hole thing!
    9·1 answer
  • What is holozoic mode of nutrition?How the food is simplified in the process of nutrition?
    15·1 answer
  • One advantage of using dns assay to detect maltose production is
    8·1 answer
  • Where is the heart on a frog? please do not use pics iam blind
    10·1 answer
  • Atoms with a low ionization energy give up their outer valence electrons with ease true or false
    6·1 answer
  • The image describes four finch species that live in an isolated ecosystem
    14·1 answer
  • What is the name for a flat, low-lying piece of land next to the ocean?
    12·2 answers
  • How would Earth be different without the greenhouse effect?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!