Answer:
radioactivity will not be able to tell the difference between the DNA and proteins
Explanation:
It seems that the experiment will fail to show what Hershey and Chase showed because they modify some of the aspects. These modifications will cause changes to the results, the main one being that radioactivity will not be able to tell the difference between the DNA and proteins. This is because Amino Acids are proteins that also contain nitrogen atoms, thus labeling the nitrogen would include all DNA and proteins. This being the main reason why Hershey and Chase decided to label the DNA instead.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
The plant which I think it says clover i can see
Explanation:
plants are primary sources of energy because it makes it own food and doesn't take form other animals.
Answer:
The population is people who buy mystery novels at that specific book store.