1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
5

One group of reptiles, characterized by the fossil Archaeopteryx, led to the evolution of _____.

Biology
2 answers:
Mamont248 [21]3 years ago
7 0

One group of reptiles, characterized by the fossil Archaeopteryx, led to the evolution of birds. The correct answer is birds

LekaFEV [45]3 years ago
4 0

<u>Answer</u>: Birds

<u>Explanation</u>:

1. Archaeopteryx is considered  as an intermediate between birds and reptiles.

2. The characters similar to birds was the presence of  feathers along its arms and tail.

3. However, the shoulder girdles, pelvis, and feet were not fused and reduced as seen in case of living birds.

4. Further, they also had teeth and bony tail.

Thus, <em>being a bridge between birds and reptiles they led to the evolution of birds.  </em>

You might be interested in
Put these time divisions in order, from longest to shortest. eon period epoch
Delvig [45]
 The order from the longest to the largest will be; Eon, Era, Period, Epoch.
Eon is the longest division of geologic time. Epoch is the shortest division of geologic time, only present in Cenozoic Era. Era is the second longest division of time, marked by sweeping changes in the fossil record. Period is the time division which is longer than an epoch but shorter than an Era. 
5 0
3 years ago
Read 2 more answers
The cereal you ate for breakfast was most like grown in a_____.
disa [49]
Grassland because cereal comes from wheat and wheat cannot thrive in a dessert or a rainforest
7 0
3 years ago
Read 2 more answers
What is a group of organisms that are able to interbreed and form viable offspring?
elena-s [515]
The answer is
A. Species
4 0
3 years ago
How the genotypeRR and Rr result in the same phenotype​
Hoochie [10]

Answer:

Explanation:     RR Rr

there will be no recieive trait

3 0
3 years ago
Please help its 6th grade science
notsponge [240]

Answer:

CAR C

Explanation:

I think

4 0
3 years ago
Other questions:
  • Which of those is an environmental coast of tar sand extraction
    9·1 answer
  • When one recognizes a friend at a party, which brain area is the first to receive the information from one's visual receptors?Gr
    15·1 answer
  • How does a plant collect energy from light?
    7·2 answers
  • What type of lipid is estrogen
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following statements about minerals is FALSE?
    9·2 answers
  • What is the process of sexual reproduction in fungi?
    7·1 answer
  • Plss anyone wanna Help?
    9·1 answer
  • What molecule is rna made from
    12·2 answers
  • In normal e. Coli cells, in which the lac operon is "on," which combination of c r p and lac repressor proteins is bound to the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!