1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bulgar [2K]
3 years ago
14

Where do scientists believe the missing carbon is going

Biology
1 answer:
sergeinik [125]3 years ago
4 0
For the answer to this question i don't know yet.
You might be interested in
Sand for beaches comes from rocks in the area that are weathered down, and
hichkok12 [17]

Answer:

Beaches would shrink until they were no longer there because the sediment is pulled away from the shores by the tide and there would be no new rock sediment to replace the old rock sediment.

7 0
3 years ago
Which part of the brain is responsible for speech?
alexandr1967 [171]

Answer:

<u>C. Broca's Area</u>

Explanation:

Broca’s area is located in the front part of the left hemisphere of your brain. It has an important role in turning your ideas and thoughts into actual spoken words. Broca’s area is the most active Source right before you speak.

Broca’s area also helps to pass the information to another part of your brain called the motor cortex, which controls the movements of your mouth. It’s named after a French doctor, Pierre Paul Broca, who discovered the region of the brain in 1861.

<u>Hope this helps!</u>

5 0
3 years ago
Read 2 more answers
^ the question is in the picture above
Ghella [55]
If the beavers need large teeth to collect wood for their dams, the population of beavers with larger teeth will live longer because they can collect wood. They will them be able to reproduce therefore passing down the gene with larger incisor teeth
5 0
3 years ago
B. Do you think sand or silt is alive?
Fed [463]

Answer:

No I don't think sand or silt is alive because it's not breathing its not an organism.

5 0
3 years ago
A human rbc is approximately 8 µm in diameter. an unknown bacterium measures 1 ocular space using the oil immersion objective co
galina1969 [7]
A)
size = (number of minor spaces x 10μm) / number of ocular spaces
       = (2 x 10) / 1
       = 20μm

b)Since the RBC has a size of 8μm and the bacterium 20μm, the bacteria is bigger. The Bacterium is bigger than the RBC by 20μm / 8μm
Hence the bacterium is 2.5 times bigger than the RBC.
3 0
3 years ago
Other questions:
  • Living near the ocean is great because the weather is mild. this is because
    14·1 answer
  • Plz Answer!! I need to double check! Which of these changes involve forming or breaking chemical bonds?
    8·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Sally was analyzing samples of DNA. She had DNA samples from bacteria, a whale shark, a bald eagle, and a human. Just by looking
    14·2 answers
  • If all cells in a human come from one zygote (fertilized egg cell), with the same genetic information (genome), how does special
    10·1 answer
  • An ecosystem that occurs close to the equator
    8·1 answer
  • Primary sensory areas of the brain have connections to association areas. What are the names, locations, and functions of the as
    7·1 answer
  • What happens to proteins as they pass through the golgi apparatus?
    9·2 answers
  • Which system sends messages about the senses to the brain
    13·1 answer
  • Why is it important that psychologists understand biology in their efforts to better understand behavior and mental processes?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!