1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
8

The National Ambient Air Quality Standards (NAAQS) are maximum allowable levels for _____ harmful pollutants.

Biology
2 answers:
iragen [17]3 years ago
3 0
The answer for the question 6

babunello [35]3 years ago
3 0

Answer:

The National Ambient Air Quality Standards (NAAQS) are maximum allowable levels for 6 harmful pollutants.

Explanation:

The EPA (United States Environmental Protection Agency) sets National Ambient Air Quality Standards for pollutants considered harmful to the population and the environment. EPA includes two standards, one includes public health protection, and the other damage to animals, crops, vegetation, and buildings. The standards must be revised periodically, they are classified by averaging time, level and form.

The EPA has set National Ambient Air Quality Standards for six principal pollutants:  

Carbon Monoxide: is harmful when inhaled in large amounts. CO is released when something is burned. The greatest sources of CO to outdoor air are cars, is recommended not to be exceeded more than once per year.

Lead: sources are waste incinerators, utilities, and lead-acid battery manufacturers and piston-engine aircraft operating on leaded aviation fuel.

Nitrogen Dioxide (NO2): gets in the air from the burning of fuel

Ozone: at ground level is a harmful air pollutant, is the main compound in smog.

Particulate Matter (PM) Pollution: a mixture of solid particles and liquid droplets that can be emitted directly from a source, for example fires, construction sites or industries and automobiles.

Sulfur Dioxide: they come from fossil fuel combustion  

You might be interested in
___ prey on animals
Aleonysh [2.5K]
Carnivores. Herbivores, on the other hand, prey on plants.
3 0
3 years ago
Read 2 more answers
A river light describe​
Leviafan [203]
A light that shines in all living things
3 0
2 years ago
Why do leaves not fall off broken branches\?
Naddika [18.5K]
<em>Leaves fall from broken branches only if they were dry.Any others will not fall</em>
5 0
3 years ago
What makes a resource renewable? A. It has a very high demand. B. It is replenished faster than it is us O C. It can never be re
irina [24]
B : It replenishes faster then it is used
4 0
2 years ago
Read 2 more answers
Question 6<br> Which of the following is not a factor of substance abuse?
Blizzard [7]

Answer:

Can you give me the options

7 0
2 years ago
Other questions:
  • Which of these is a function of the xylem?
    13·1 answer
  • The main hazard from a quiet volcanic eruption is a. volcanic gases. b. lava flows. c. geysers. d. pyroclastic flows.   Please s
    5·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the phenotypic and genotypic ratio of a cross between 2<br> heterozygous green pea plants?
    14·1 answer
  • Livestock emissions can lead to acid rain.<br> True or false ?
    6·1 answer
  • What does dilation, and therefore increased permeability, of the capillaries during the inflammatory response allow to happen
    13·1 answer
  • Black fur(B) in quinea pigs is dominant over white fur(b). Find the probability of a white offspring in a cross between two hete
    6·1 answer
  • How to fund Id in this app​
    9·2 answers
  • How are the Archaeabacteria different from the Eubacteria?
    6·1 answer
  • What is the speed of grid method in forensics
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!