1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
3 years ago
14

How does the injection of insulin affect the signal transduction pathway of type 1 diabetics?

Biology
1 answer:
kotegsom [21]3 years ago
8 0

Answer:

The correct answer is D.

Explanation:

To act on target cells, insulin binds to a specialized protein that is located on the membrane of your target cells: the insulin receptor. When insulin binds to the receptor, it activates a cascade of signals within the cell (a process called signal transduction), which is essential for insulin to have an effect on its target tissues. Insulin increases the entry of glucose into cells and causes the number of certain proteins specialized in glucose transport to increase in the membrane of their target cells, such as adipocytes (adipose tissue cells) and skeletal muscle cells.

You might be interested in
Infer: what is the relationship between the evolution of bipedalism, the increase in cranial capacity, and the decrease in tooth
noname [10]
When the organism become bipedal, they walk with 2 legs so there are 2 arms that were unused. Some of them try to use that hand by grabbing stick or stone, leading to tools. They start to think more to develop tools and their brain capacity become increased.
The ability to use stone tools will help in food digestion since it can break the food easier. This reduces the needs for bigger teeth/jaw.
3 0
3 years ago
How do animal-like protists differ from plant-like protists?
Genrish500 [490]
I think its a please let me know if im wrong 
8 0
3 years ago
Read 2 more answers
Assume a normal female with a resting tidal volume of 400 ml, respiratory rate of 13 breaths/min, and dead space of 125 ml. When
bija089 [108]

Answer:

Resting alveolar ventilation is = 3575 ml/min

Exercising a) 5500 ml/min

b) 5525 ml/min

c) 5625 ml/min

increasing both rate and depth has the largest effect and this would happend in real life

4 0
3 years ago
An_____looks like a circle with two longer, flatter sides.
MariettaO [177]

Answer:

C an ellipse

Explanation:

5 0
3 years ago
Read 2 more answers
Flatworms have a concentration of nerve tissue and organs in one end of the body. What is the name of this characteristic? Nerve
Akimi4 [234]

Flatworms have a concentration of never tissue and organs in one end of the body. That characteristic would be called, cephalization.


I hope this helps!!



7 0
3 years ago
Read 2 more answers
Other questions:
  • The mitral valve separates which two chambers of the human heart?
    6·1 answer
  • The diagram below shows a process that occurs in cells.
    13·1 answer
  • What does it mean to say that double-stranded nucleic acids are<br> antiparallel?
    12·1 answer
  • Thick fluid between the nucleus and the cell membrane
    11·2 answers
  • Match each step of the scientific method with its description
    5·1 answer
  • When fertilizers run off farmland into streams and ponds, the nitrogen content of the water increases. This can lead to rapid gr
    14·1 answer
  • Which of the following are the oldest remnants from the formation of the
    5·1 answer
  • Is mucous an enzyme or harmone​
    12·1 answer
  • What question do you have about purberty.
    8·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!