1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
4 years ago
14

Warm air expands and rises creating an area of

Biology
1 answer:
Finger [1]4 years ago
8 0
Lover pressure...... .
You might be interested in
Which of the following terms describes all of the non-living components of an ecosystem
Svet_ta [14]

Abiotic: which are the non-living factors and chemicals in environments which can affect the ecosystem.

6 0
3 years ago
Read 2 more answers
Seasonal changes occur because of
Mnenie [13.5K]
Seasonal changes occur because of earth's tilt
8 0
3 years ago
Read 2 more answers
Identify the areas on the image where the force of repulsion is the last
zavuch27 [327]
We need a photo so I can give u an answer
8 0
3 years ago
Read 2 more answers
Which of the following is not one of the important concepts of evolutionary theory?
viktelen [127]
I think nutrition isn’t one of the important concepts
4 0
3 years ago
2. Is the following sentence true or false? As a cell increases in size, it usually makes extra copies
jeka57 [31]

Answer:

false

Explanation:

8 0
3 years ago
Other questions:
  • we know that tiktaalik is more closely is more related to acanthostega than it iscanyhostega eusthenopteron because tiktaalik an
    9·1 answer
  • An ___ section of music will be smooth and connected?
    9·1 answer
  • Base on the chemical equation of photosynthesis, 6CO2 + 6H2O ----> C6H1206+ 602, what is substances
    6·2 answers
  • A fossil of a burrow left by an organism would be an example of what type of fossil?
    9·2 answers
  • The data above indicate an error. How do you know? What might have caused the error​
    6·2 answers
  • Which best describes the relationship of the embryo and the fetus
    10·1 answer
  • What is the role of NaCl and edta in DNA isolation?
    10·1 answer
  • PLEASE DO THIS WITH YOUR OWN WORDS 20 POINTS
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • I NEEED THE ANSWER ASAP PLEASE What is the difference between a sound wave and a light wave? Select all that apply. A A sound wa
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!