1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margarita [4]
3 years ago
5

Hemoglobin functions to transport ...... ?

Biology
1 answer:
ira [324]3 years ago
6 0
Hemoglobin is an important component of red blood cells that functions in transporting majority of oxygen in the body. One hemoglobin can bind to up to four oxygen molecules because of its four subunits. If the oxygen carrying ability of hemoglobin is decreased, carbon dioxide and temperature will increase and pH will decrease.
You might be interested in
In the savanna, many animals have adapted a ___________ pattern in which they follow the water and food supply.
irina1246 [14]

Answer:

The answer is migration.

7 0
3 years ago
In plants, meristematic cells are most similar to which type of cells in animal tissues?
aliya0001 [1]

Answer:

B. Stem Cells

Explanation:

6 0
2 years ago
Read 2 more answers
Question in link below.
bezimeni [28]

The correct answer is - They supply the energy needed for living processes.

Both the carbon and the nitrogen, are gases that are crucial for the survival of the organisms on the planet. They are mostly used by the producers in the ecosystems, as they need them to manage to perform their cycles, get nutrition, and of course energy. The producers are the basis of the ecosystems, so if they do not have a healthy supply of carbon and nitrogen, the ecosystems on the whole planet will collapse. The carbon and the nitrogen later go from one organism to another as the energy is transferred, and usually end up back into the atmosphere again.

4 0
3 years ago
Thymine dimers can be repaired by Photoreactivation Repair or Nucleotide Excision Repair. - true or false?
Aleksandr-060686 [28]

Answer:True

Explanation:Basically thymine diamers are mismatched pairs (thymine binds with another thymine instead of binding with adenine) and may lead to unwanted results so the mismatching can be repaired by using two methods which are as follows :

1-the PRE enzyme activated by blue light breaks the thymine diamer and some of the surrounding bonds the strand is cut and DNA polymerase then restores the normal base pairing

2-UVR system breaks dimer creating a gap when a gap is created and the molecules appear unpaired it is filled by proof readers hence restoring normal base pairing.

6 0
3 years ago
What genus are humans in?<br> A. Homo<br> B. Sapiens <br> C. Erectus<br> D. Sula
EleoNora [17]

The answer is A Homo

8 0
3 years ago
Read 2 more answers
Other questions:
  • As air moves away from the tropics and toward the poles, it becomes
    13·2 answers
  • Where does rna polymerase begin transcribing a gene into mrna? see concept 17.2 ( page 342)?
    8·1 answer
  • The ability to adjust to changed sensory input is called
    10·2 answers
  • Which chromosomal change is represented?
    9·1 answer
  • The flu virus mutates very easily due to its core made of RNA. This type of virus is called a(n) ...
    11·1 answer
  • If Jack and Jill have a child with an Aaa genotype, during which meiotic division, and in which parent, could nondisjunction hav
    13·1 answer
  • What is the mass of the light bulb?
    14·1 answer
  • The pedigree below shows two generations of individuals within a family. The pedigree shows
    6·1 answer
  • 1 Reproduction is an important characteristic of living organisms.Explain<br><br>​
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!