They are known as evolutionary biologists. Strictly speaking, anthropology is split up into a number of disciplines - physical (sometimes known as biological) anthropology is the study of evolution as it relates to human beings. Further to this, scientists who study evolution in the fossil record are known as evolutionary palaeobiologists or simply palaeobiologists.
Answer:
large mammals such as gorillas
Explanation:
The survivorship curves refer to the graphical representation of the proportion of the fraction of survivors or the individuals at a given age.
There are three types of survivorship curves which can be constructed by studying the life history of the organisms.
The type I survivorship curve is the curve which can be formed with the organism which has a high survival rate at the younger and middle age and high death rate at the older age. The type I curve can be characterised by its convex shaped. The type I is showed by the large mammals like gorilla, humans and many others.
Thus, large mammals such as gorillas are the correct answer.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Contracted blood vessels
Explanation:
The volume of blood is reduced as the vessels are more narrow due to the contraction, so less blood reaches the respiring tissues, causing the force of blood flow to increase as there is less space for normal blood flow to occur. This means that blood pressure increases.
Feeding relationships in which organisms feed on a variety of organisms is called a food web.
