1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
12

The main goal of developing technology is to

Biology
1 answer:
quester [9]3 years ago
5 0

A)  

learn about the universe and the laws of nature.  

B)  

design new scientific instruments.  

C)  

make new inventions and processes to benefit humans.  

D)  

make new scientific discoveries.


I believe the correct answer is C, but I'm 100% on this.  Hope this helped though!

You might be interested in
In beans, the black color of the seeds (A) dominates over the white (a). When two bean plants were crossed with black seeds, pla
Savatey [412]

Answer:

mark me brainleast then I will be

8 0
3 years ago
The exchange of segments of dna between the members of a pair of chromosomes is called:
Kitty [74]

Answer:

Chromosomal translocation

Explanation:

Segement of DNA in a chromosome is trans(ferred) located (location) to another chromosome, vice versa.

6 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
The difference between generalized and specialized transduction is:___________
Rzqust [24]

Answer: option D

In generalized transduction, any DNA can be moved while in specialized transduction certain DNA from the phage site is moved.

Explanation:

Transduction is the process where foreign DNA is added to a cell by a virus or viral vector.

Transduction is divided into two, generalized and specialized.

Generalized transduction is a process where any DNA can be transferred by the virus in the cell while specialized transduction is a process where a fragment of the DNA near the phage site can be moved.

6 0
3 years ago
1.) What gives water all its properties? 2.) What type of bond joins H2O to another H2O and forms cohesion? 3.) What property of
Yuri [45]

Answer:

1. polarity

2. hydrogen bonding

3. High heat capacity

4. Adhesion

5. polarity

6. surface tension

7. high heat vaporization

8. hydrogen bonds form a rigid and stable network

9. Water is a polar substance and fat is a nonpolar substance.

10. Cohesion

Explanation:

Water is a polar molecule that is held together by hydrogen bonds to form strong cohesive forces. This accounts for the surface tension in water. Surface tension is the force acting on water that it makes to behave like a stretched elastic skin.

The polarity of water accounts for the fact that it is found in several parts of the body where it largely plays the role of a polar solvent.

High heat capacity of water enables it to function well in the area of thermoregulation in the body. High heat vaporization accounts for the fact that water helps maintain extreme temperature changes in an area.

When in solid state, the hydrogen bonded network in water becomes rigid and forms a very stable network of water molecules. Being polar, water does  not interact with fat because like dissolves like.

In plants, the attachment of water to plant roots is known as adhesion and is necessary for the capillary movement of nutrients to plants via the root.

5 0
3 years ago
Other questions:
  • Ribosomes can be found on the surface of the endoplasmic reticulum and suspended in the cytoplasm.
    10·1 answer
  • What bone marking is the raised area on or above a condyle?
    6·1 answer
  • Raul plans to start jogging after being sedentary for 2 years. what is the first step he should take? make sure he is medically
    13·1 answer
  • What difference in traits is caused by chromosomes?
    13·1 answer
  • Why is it important for science and society to communicate about stem cell research?
    14·1 answer
  • 17. Which of the following is comprised primarily of fatty acids and other single tailed amphiphiles? A) lipid bilayers B) two-d
    5·1 answer
  • Identify whether this describes heat or temperature.<br> Symbol for the unit of measurement: C
    8·1 answer
  • Can similar mineral composition be found in rocks both the Rocky Mountains and the Great Plains even though the rocks look so di
    13·1 answer
  • Atoms of which pair of elements will form ionic bonds in a compound
    13·2 answers
  • AMP-PNP is the abbreviation for a structural analogue of ATP in which the second and third phosphate groups are linked by an NH
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!