1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vadim26 [7]
3 years ago
10

Male cones produce ______ which contains cells that develop into sperm.

Biology
2 answers:
romanna [79]3 years ago
7 0

Answer:

yeah i was gonna say pollen cuz no one else had the right answer

Explanation:

alexgriva [62]3 years ago
5 0

Answer:

Yes the answer would be pollen

Explanation:

You might be interested in
In the summer, coastal towns usually experience cool ocean breezes, as shown in the
ra1l [238]
There is no option or ocean breezes show
8 0
3 years ago
An Asian elephant has a weight of 52,900 newtons. This enormous weight is balanced on four feet. In a circus act, these elephant
Aleonysh [2.5K]

Answer:

Option B, 18.11 \frac{N}{cm^{2}}

Explanation:

Given-

The average surface area of one foot pad of an elephant is 2920 cm^{2}\\

Weight of an Asian elephant is 52900 newton

As we know, pressure is equal to total weight divided by total area of the surface on which it is concentrated.

Thus, pressure on one foot  pad of elephant is \frac{52900}{2920} \frac{N}{cm^{2}} \\

= 18.11\frac{N}{cm^{2}}

Hence, option B is correct answer

7 0
3 years ago
Which statement best describes the relationship of photosynthesis and energy?
Afina-wow [57]

Answer:

The correct answer is The process of photosynthesis is energy storing because the process converts light energy into chemical energy which stored in the bonds of glucose.

Explanation:

During photosynthesis the light harvesting complexes absorb sunlinght and transfer that light energy to the reaction centre of photosystem.The photosystem then converts the light energy into chemical energy in form of ATP.

      The ATP molecules are used along with NADPH to form glucose in the dark reaction of photosynthesis.

7 0
3 years ago
Read 2 more answers
Which process has the greatest effect in determining which members of a population are most likely to survive until reproductive
Citrus2011 [14]
It should be natural selection since there is no external influence implied. (like environment or genetic mutations.)
7 0
3 years ago
Decomposers make ______<br> available.<br> A. erosion<br> B. air<br> C. weathering<br> D. nutrients
bekas [8.4K]

Answer:

D

Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • Availability of substitutes plays a role in determining the bargaining power of suppliers.
    15·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the function of the kidneys? to filter waste material from the blood to convert glucose into glycogen to add oxygen to t
    12·1 answer
  • Why is maintaining homeostasis important to organisms? Question 16 options: Their internal environment must provide their cells
    11·1 answer
  • Which gland is the master gland in human body
    9·2 answers
  • Which of these animals undergoes complete mertarmorphosis
    12·1 answer
  • Ttybbe&amp;cr edddbehegeheehwwwyyww
    6·1 answer
  • I need help PLZZ this will mean a lot
    14·1 answer
  • Rheumatoid arthritis is an autoimmune disease in which the immune system becomes overactive and attacks the body’s own tissues.
    7·1 answer
  • Where does mold come from?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!