1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
daser333 [38]
3 years ago
6

1. Describe the structure and function of the specialized cells you observed in the video. 2. Research the types of cells presen

t in the kidney.
Biology
1 answer:
Vinvika [58]3 years ago
5 0

Answer:The structure and functions of cells that found in the video include:

Explanation:

1. Nucleus:

Structure=it is a spherical body which is covered by a double membrane which contains hereditary materials.

Functions= it controls all life activities of the cell. It stores hereditary information as it contains DNA.

2. Mitochondria:

Structure: They are oval or rod shaped and bounded by a double membrane

Functions: They are site of cellular respiration.

3. Ribosomes:

Structure: They are small round bodies attached to endoplasmic reticulum.

Functions: They are responsible for protein synthesis.

4. Endoplasmic reticulum:

Structure: They are membrane-like structure that forms channel within the cytoplasm.

Functions: they aid transport of materials within the cytoplasm.

Golgi bodies:

Structure: They are series of disc-shaped sacs.

Functions: They function in synthesis, packaging and distribution of materials within the cell.

2. Types of cell present in kidney

-messangial cell

- Loop of Henle

-podocytes

You might be interested in
10. Cloud droplets form and grow as water vapor condenses onto hygro-
Natali [406]

Answer:

According to collision- coalescence theory, formation of raindrop from cloud droplets occurs when cloud droplets collide and coalesce or stick together.

Explanation:

  • The only significant difference between a raindrop and a cloud droplet is that a raindrop consist of a velocity that is non-negligible during the fall.
  • Larger droplets having higher terminal velocities fall faster and collide with smaller droplets. Often the cloud droplets stick together and coalesce to form a larger droplet.
  • This starts a chain reaction where these bigger droplets fall even rapidly, collide with the other droplets in their path and merge with these droplets.
4 0
3 years ago
How many times do humans blink a day
lana66690 [7]
Around 28800 times a day. Hope this helps :)
3 0
3 years ago
How are proteins regulated after translation? active proteins can be inactivated by post‑translational modification existing mRN
Sonja [21]

Answer:

inactive proteins can be activated by phosphorylation

Explanation:

Proteins are regulated after translation by the non-covalent binding of small molecules. These molecules include amino acids or nucleotides. A change in the conformation and thus, the activity of the protein is usually achieved when this occurs.

Proteins could also be regulated by phosphorylation which is the addition of phosphate groups of specific amino acids on the protein.

3 0
3 years ago
What does it take the Earth on full year to complete
Oksana_A [137]

It takes the Earth (approximately) 364.25 days to revolve around the sun. That's why we have leap days.

Hope that helps!

5 0
3 years ago
Read 2 more answers
PLS HELP 25 points
SSSSS [86.1K]

Answer:

C. Pseudo science is also known as 'fake science' because whatever is said is impossible to prove with the scientific method, and a pseudoscientist's mindset is that it's correct until proven wrong.

8 0
3 years ago
Other questions:
  • Which of the following strands is the correct complement to the strand ATC-GTC-CCA
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What best declscribes the scientific method
    12·1 answer
  • Describe how the structure of a turtle's heart allows for flexibility in blood circulation
    10·1 answer
  • Match the phases in the cell cycle to the events that occur in each phase.
    12·2 answers
  • Assume that a cell is carrying out its day-to-day activities. At one point, the nucleotides GAT are paired with the nucleotides
    13·1 answer
  • Rhizobium A. fix nitrogen inside nodules on the roots of legumes.B. resemble fungi.C. produce antibiotics.D. produce a gall in p
    8·1 answer
  • Latoria is horseback riding when she falls and hits her head. after the accident, she has difficulty performing finely coordinat
    11·1 answer
  • What are the chances of getting pregnant from precum?
    13·1 answer
  • 18. Why does DNA Replication have to happen at this stage of the cell<br> cycle? *
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!