1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
7

What are cells that express the same genes? A. The same B. Differentiated C. Mutated D. Not living

Biology
2 answers:
goblinko [34]3 years ago
6 0
The answer would be A
Juli2301 [7.4K]3 years ago
5 0
The answer would be c because if you has a gene That shared the same trait as a different gene, than it had to have mutated
You might be interested in
According to the article why is it important for pikas to find cool habitats
Svetllana [295]
Their normal body temperature is high, and this puts them at risk of overheating when they’re active in warm environments
4 0
2 years ago
The relationship between a carnivore and an herbivore can be stated as
ki77a [65]

Answer:b

Explanation:

7 0
2 years ago
Read 2 more answers
Which statement about an ecosystem is incorrect?
kumpel [21]
There is a community of organisms but no no living components
6 0
3 years ago
What would the temperature of the<br> surface be if the Earth did not have an<br> atmosphere?
slava [35]

Answer:

The temperature of Earth's surface if there was no atmosphere would be over 200 degrees (F) in the daytime and below 200 degrees (F) at night.

3 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Other questions:
  • 7. Which land biome has the greatest diversity of plant species, and which has the least? a.grassland: most; tundra: least b.rai
    6·2 answers
  • A person has entered a hunger strike. After 60 days of starvation, this person is on the edge of dying. What is likely to be the
    5·1 answer
  • Advances in biotechnology have given us genetically modified tomatoes that can survive shipping and arrive at the grocery store
    6·2 answers
  • Ow does the zygosporangium of Rhizopus stolonifer function to ensure the survival of the species?
    12·1 answer
  • Which diagram shows an ionic bond?
    10·2 answers
  • When a scientist is conducting research about all the plants and wildlife in the Mojave Desert as well as the desert’s resources
    5·2 answers
  • Can somebody help me plzz with number 1. 2. 3. 4. 5. And 6. plez
    13·1 answer
  • Why a red blood cell burst when placed in water yet an onion epidermal cell does not?​
    13·1 answer
  • What is the current research and technology of the resource on plastic<br><br> This is for 25 points
    5·2 answers
  • Calculate the molality 6.75% solution of ethanol in water​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!