1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
5

Nucleic acids are biological polymers that are comprised of nucleotide monomers covalently bonded together.

Biology
1 answer:
lyudmila [28]3 years ago
8 0

Answer:

C is the correct answer

You might be interested in
The human population grows by about 2% each year, showing_____ growth.
stepan [7]

Answer:

C. Exponential

Explanation:

6 0
3 years ago
Read 2 more answers
1.What do other organisms rely on plants for?
Black_prince [1.1K]

Answer: Organisms depend on other organisms and on the nonliving things in an ecosystem to meet their basic needs for food, water and protection. 3. Plants use energy from the sun to produce their own food from air and water.

Explanation:

3 0
3 years ago
Read 2 more answers
The _____ is a type of regulator protein that binds to a region of dna in the promoter of a gene called the operator and prevent
vivado [14]

The<u> repressor </u>is a type of regulator protein that binds to a region of DNA in the promoter of a gene called the operator and prevents transcription from taking place.

In the field of science, a regulator protein can be described as a kind of protein that affects the transcription of a gene by having an influence on particular DNA sites. The rate of synthesis of various proteins is controlled by the regulator proteins.

A repressor is a kind of regulator protein that prevents the transcription of a particular gene. When the rate of a protein in the body has reached normal, the transcription of the protein needs to be stopped in order for more protein of that kind to be formed. The repressor binds itself to the operator region for the gene, hence stopping the transcription process until the protein is required again.

To learn more about repressor, click here:

brainly.com/question/13799037

#SPJ4

6 0
1 year ago
SOMEONE PLZ HELP!!!!!!!!
aivan3 [116]
A - Endoplasmic Reticulum.
8 0
3 years ago
Choose all answers that apply
Nutka1998 [239]

Answer:

<em><u>is</u></em><em><u> </u></em><em><u>made</u></em><em><u> </u></em><em><u>of</u></em><em><u> </u></em><em><u>a</u></em><em><u> </u></em><em><u>double</u></em><em><u> </u></em><em><u>layer</u></em><em><u> </u></em><em><u>of</u></em><em><u> </u></em><em><u> </u></em><em><u>phospholipids</u></em>

3 0
3 years ago
Other questions:
  • The small units that make up the macromolecule DNA are called
    7·1 answer
  • Which Sentence Best Describes Exocytosis?
    5·1 answer
  • In the male reproductive system, the pituitary hormone _____ stimulates Leydig cells to secrete testosterone, and the pituitary
    15·1 answer
  • Which list shows the levels of organization of an organism in hierarchical order from left to right, from the smallest to the mo
    12·1 answer
  • How does carbon get in the ocean?
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The production of ammonia in the reaction catalyzed by glutamate
    6·1 answer
  • Aerial roots are present in:-
    10·1 answer
  • HELp I will mark brainlyest if correct
    6·2 answers
  • Scientists have determined that Earth's interior has layers with different properties. One property is that the inner core is so
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!