1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kari74 [83]
3 years ago
6

Explain how the Earth itself is a system and describe an example of an interaction within this system.

Biology
1 answer:
Tanzania [10]3 years ago
5 0

Answer:

The Earth is made of several subsystems or "spheres" that interact to form a complex and continuously changing whole called the Earth system.

Explanation:

You might be interested in
Bacteria decompose dead matter byb
levacccp [35]
The answer is C. I hope this helps
4 0
3 years ago
It's most important for hospital staff to know their facility's protocols so O A. employees do not injure patients or themselves
belka [17]
This is rly not my level but i take honor classes so i’m above average, i think the answer is D. it’s the most logical to me if you rly want to know
8 0
3 years ago
Read 2 more answers
11. In which of the following examples will water move into the cells of the large intestine from the outside environment by the
tamaranim1 [39]

Answer:

Osmosis is the diffusion of water molecules, from a region of higher concentration to a region of lower concentration, through a partially permeable membrane. A dilute solution contains a high concentration of water molecules, while a concentrated solution contains a low concentration of water molecules.

Explanation:

hope it helpsss

4 0
3 years ago
The feeding step an organism occupies in a food chain is known as a ____
tatuchka [14]

Answer:

Trophic level

Explanation:

5 0
4 years ago
After taking antibiotics for several weeks, a patient develops a severe bacterial infection in his intestines. The doctor claims
Leokris [45]

Answer:

Before the antibiotic, the ‘good’ bacteria had colonized her intestines and formed colonies that made up her biome. These colonies out-compete other bacteria, including ‘bad’ bacteria that tried to grow in the intestines hence protecting her intestines from infection.

However, the antibiotics wiped out the established colonies of ‘good’ bacteria –destroying her biome- and gave room for recolonization of the intestines by bacteria. The secondary succession gave a chance for the ‘bad’ bacteria to also thrive and cause her massive infections.

5 0
3 years ago
Read 2 more answers
Other questions:
  • It is easier to assign a specific age to rocks containing fossils that
    15·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Identify the fungus type pictured below.
    10·2 answers
  • How do ecologists classify aquatic ecosystems ?
    9·1 answer
  • What would happen if we found a way to get rid of pollen?
    15·1 answer
  • Summarize how mutation violates the Hardy-Weinberg<br> principle
    5·1 answer
  • If a homozygous blood type B father and a blood type O mother produce a child, what is the probability that the child will have
    12·1 answer
  • Naszxxxxxxxxxxxxxxxxxxxxxxxxxxxx
    12·1 answer
  • What do you understand by the term disease .write it's types​
    7·1 answer
  • Diffusion is the movement of ________________ from an area of __________ concentration to an area of _______ ___________________
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!