1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blsea [12.9K]
3 years ago
11

What might occur when mitosis is not stopped or occurs quickly due to the presence of cancer.  

Biology
1 answer:
leva [86]3 years ago
4 0
In a cell, there are several parts of it that are there to stop this from happening. Cancerous cells do not have the genetic code to stop growing and reproducing. A regular cell will actually destroy itself it there is a mutation. If it does not get destroyed, it could potentially be tumorous, then it could eventually be cancerous.

You might be interested in
Any good hypothesis idea?​
Lorico [155]

Answer:

is plant growth affected by temperature

Explanation:

4 0
2 years ago
Chemical reactions are like an equation with :
alukav5142 [94]

Answer:

Reactants= Products

Explanation:

Reactants are what are required to start the reaction. Products are the ending result.

4 0
3 years ago
Stomata- specialized cells that contract and expand to open or close pores for gas exchange. Stomata can adjust to temperature,
mr Goodwill [35]

Answer:

CLOSED.

Explanation:

Stomata are found in epidermal layers in green aerial parts of plants, especially leaves. They occur mainly on the lower surface of dicotyledonous leaves, although on monocotyledonous, they are found on both surfaces. Intercellular air spaces found throughout the leaf are linked to stomata.

Stomata permits plant uptake of carbon dioxide, which is a necessity for photosynthetic processes. They also help to reduce water loss by closing when conditions are hot or dry. Stomata look like tiny mouths which open and close as they assist in transpiration.

Therefore, it can be said that Stomata adjust temperature, staying closed when temperatures are hot and dry.

3 0
2 years ago
Explain how mutations to genes can affect traits in organisms.
Harlamova29_29 [7]

Answer:

Genetic variations that alter gene activity or protein function can introduce different traits in an organism. If a trait is advantageous and helps the individual survive and reproduce, the genetic variation is more likely to be passed to the next generation (a process known as natural selection)

8 0
3 years ago
HELPPPP, ASAPPP THEY ONLY GAVE ME A FEW MINUTES TO COMPLETE!!
zhenek [66]

Answer:

hmm I'd say something like "Solar and Wind energy systems are renewable sources and ultimately are healthier for the planet, the drawback is that other resources (i.e oil and coal) tend to be cheaper"

5 0
3 years ago
Read 2 more answers
Other questions:
  • What can be concluded about Clades 2 and 4 from this cladogram?
    8·2 answers
  • Figure 1. Model of water movement through the xylem, with magnified models of water movement in the stem and leaf. Which stateme
    15·1 answer
  • Gravitational, elastic, and chemical are three forms of what energy
    7·1 answer
  • The sugar and phosphate portion of the nucleotides are found _____ on the DNA twisted ladder.
    8·1 answer
  • How is skin cell relate to its function
    15·1 answer
  • ¿Por que crees que hoy en día se ha incrementado la importancia de la ecología?
    7·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • What unique characteristic does the bonding of carbon to other atoms have and why is this important for organic molecules?
    8·1 answer
  • During which phase of meiosis are the chromatids first separated from each other?.
    10·2 answers
  • Question 13 (1 point) Which of the following processes add methane (CH4) to the atmosphere in the carbon cycle?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!