1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
4 years ago
6

Predict and explain the long term effect on the environment of obtaining and using limestone

Biology
1 answer:
timama [110]4 years ago
8 0
Limestone is essential for the formation of petroleum reservoirs

Limestone is great for soil as due to its structure, it can buffer acidic chemicals in soil

It is useful in the prevention of explosions from mining that are caused from too much methane release

It is useful in mediating the effects of erosion the the environment
You might be interested in
Biodiversity is important to maintain stability in an ecosystem. In order to maintain species numbers over time, which two proce
blagie [28]
Emigration and immigration
6 0
3 years ago
What is the role of the ribosome?
salantis [7]

Answer:

B. they assume the role od bringing 2 amino acids together

3 0
4 years ago
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Eddi Din [679]

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

4 0
3 years ago
What facts about the immune system can be used to determine who is right
Anarel [89]
............................
6 0
3 years ago
What are genetic instructions called?.
yanalaym [24]

A genome is an organism's entire set of genetic commands. each genome incorporates all the information had to construct that organism and allow it to grow and develop.

The genome is the entire set of genetic commands discovered in a cell. In human beings, the genome includes 23 pairs of chromosomes, discovered in the nucleus, in addition to a small chromosome determined inside the cells' mitochondria.

Your genes contain commands that inform your cells to make molecules called proteins. Proteins carry out various functions for your body to keep you healthful. every gene consists of instructions that decide your functions, together with eye shade, hair coloration, and height. There are extraordinary variations of genes for every characteristic.

Allan Maxam and Walter Gilbert posted a DNA sequencing method in 1977 based on the chemical amendment of DNA and the next cleavage at unique bases. additionally referred to as chemical sequencing, this method allowed purified samples of double-stranded DNA for use without further cloning.

Learn more about genetics here:

brainly.com/question/25703686

#SPJ4

7 0
1 year ago
Other questions:
  • A young woman was brought into the emergency room because of repeated seizures. her roommate said that the woman had taken the d
    14·1 answer
  • It's A right??? I'm like 10000000% positive it is..
    8·2 answers
  • Both viruses and cells have?
    12·1 answer
  • How does a squid produce ink
    14·1 answer
  • How virus spread on sneezing and cause disease in a normal healthy pearson?
    15·2 answers
  • Nerve impulses travel like____ signals through wires.
    11·1 answer
  • If you describe methane as a gas that easily catches fire, you are describing a ________.
    5·2 answers
  • Do you think either students method would give more accurate results
    5·1 answer
  • If certain ocean species were to die out from ocean
    6·1 answer
  • Which of these phases encompasses all of the stages of mitosis? A pie chart of the cell cycle that consists of two parts. The bi
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!