Answer:
B. they assume the role od bringing 2 amino acids together
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
............................
A genome is an organism's entire set of genetic commands. each genome incorporates all the information had to construct that organism and allow it to grow and develop.
The genome is the entire set of genetic commands discovered in a cell. In human beings, the genome includes 23 pairs of chromosomes, discovered in the nucleus, in addition to a small chromosome determined inside the cells' mitochondria.
Your genes contain commands that inform your cells to make molecules called proteins. Proteins carry out various functions for your body to keep you healthful. every gene consists of instructions that decide your functions, together with eye shade, hair coloration, and height. There are extraordinary variations of genes for every characteristic.
Allan Maxam and Walter Gilbert posted a DNA sequencing method in 1977 based on the chemical amendment of DNA and the next cleavage at unique bases. additionally referred to as chemical sequencing, this method allowed purified samples of double-stranded DNA for use without further cloning.
Learn more about genetics here:
brainly.com/question/25703686
#SPJ4