Genes: the heredity code ANSWER PLEASE

Biology

2 answers:

zepelin [54]3 years ago

8 0

Topoisomerase is the enzyme that unwinds the double helix structure of the DNA. Topoisomerase helps the helicase to break DNA double helix structure so the amino acid in DNA strand will be exposed so the helicase can make an RNA copy out of it. The location should be just before the DNA become unwind, a bit in front of the helicase.

+
here +
_____________+
_____________
+
+

GuDViN [60]3 years ago

3 0

Right here i added an image so u can see this and answer :D

You might be interested in

When did arundant fossil evidence first appear in the geologic record

Delvig [45]

<h2>540 million years ago </h2>

Paleozoic.

Era immediately follows Precambrian It lasted about 4.5 billion years.

When did abundant fossil evidence first appear in the geologic record.

540 million years ago.

7 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein