1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol [13]
4 years ago
9

Which type of soil holds the least water? loam clay sand silt

Biology
2 answers:
Nataliya [291]4 years ago
4 0

Answer:

Sand

Explanation:

Sand, with its larger particles and low nutritional content, retains the least amount of water, although it is easily replenished with water.

Alla [95]4 years ago
4 0

Answer:the answer is sand

Explanation: Clay soil has small, fine particles, which is why it retains the most amount of water. Sand, with its larger particles and low nutritional content, retains the least amount of water, although it is easily replenished with water. Silt and loam, with medium-size particles, retain a moderate amount of water.

You might be interested in
Which of the following accurately describes immWhich of the following accurately describes immunity?
AlexFokin [52]
The answer should be option "b" 
6 0
4 years ago
Six fingered offspring are formed from normal fingered parents . why?
Alex777 [14]
<span>Polydactyly in its most common form, is an autosomal dominant mutation. Let's represent the mutation as P and the normal state as +. Thus, if both parents are heterozygous (P+), both would have the mutation (and thus have six fingered). They have 3/4 chances of having a child with the extra digit, 1/4 normal. </span>
3 0
3 years ago
The giant short-faced bear disappeared completely from North America about 12 million years ago due to competition from smaller
Olin [163]
The answer is C hope it helps 
7 0
3 years ago
Read 2 more answers
What’s amnio acids mean
Andrews [41]

Answer:

Amino acids are organic compounds that combine to form proteins. Amino acids and proteins are the building blocks of life. When proteins are digested or broken down, amino acids are left. The human body uses amino acids to make proteins to help the body: Break down food.

7 0
4 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Which human activity is correctly paired with the greenhouse gas that it increases?
    11·2 answers
  • A. You are performing experiments with your protein of interest and its ligand. You are attempting to mutate the binding site of
    10·1 answer
  • Which of the following is a biotic factor?
    7·1 answer
  • What questions do you have about skin and skin color?
    5·1 answer
  • How do scientific most often gain new knowledge?
    13·2 answers
  • A member of a population of genetically identical organisms that were produced from a single cell.
    15·1 answer
  • A chromosomally normal (XY) male was born with a penis just one centimeter long and a small opening similar to that of a female
    13·2 answers
  • Why would small plants attach themselves to the sides of large trees high above the ground
    9·2 answers
  • Global Energy
    7·1 answer
  • Neurotransmitters can __________________ receptors to turn them on or __________________ them to stop them from transmitting.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!