1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
14

7. Mrs. Everhart developed the theory that all bulldogs are great pets. After all her bulldog Meatball is a

Biology
1 answer:
Leno4ka [110]3 years ago
8 0

Answer:

No it is not a scientific theory.

Explanation:

An explanation of any aspect of the natural phenomenon of the world that can be tested several times and well supported by the evidence, and follows the scientific method. Furthermore known as scientific theory.

Presently, a logical hypothesis must meet a few rules, and one of those is that it must be upheld by a few (and free) strands of proof.  

For this situation, we have just one hypothesis, that bulldogs are great pet and Meatball is great among bulldogs, and it isn't sufficient, at that point it can not be a scientific theory.

You might be interested in
The main purpose of cell respiration is to:
yan [13]

Answer:

The main purpose of cell respiration is to:

b. convert the chemical energy in sugars into ATP

5 0
3 years ago
Read 2 more answers
Sam’s teacher is trying to model the day/night cycle on Earth. One student holds a large yellow ball to represent the Sun. Anoth
Orlov [11]
Hello!

So, day and night are caused because the earth makes a full rotation on its axis once every 24 hours.

That way, have of Earth is facing the sun (it is morning on that side) and the other half isn't (which is why it is nighttime over there).

For example, if it's nighttime in Canada and America, it's morning in Pakistan and India. This is because Pakistan and India are facing the sun whilst Canada and America are not.

A N S W E R:

The balls should be moved so that half the Earth is facing the sun and the other half is not. This would be 24 hours. As for the sun, it is a gas, not a solid, so it doesn't rotate like one. However, that does not mean that it is not rotating to some extent.
4 0
4 years ago
Read 2 more answers
Which question is most likely to be studied by biologists?
Nimfa-mama [501]

Explanation:

The question that is most likely to be studied by biologists could be "What is the effect of exercise on heart rate in horses?" since they study everything related to the Life. <em>Hope</em><em> </em><em>this</em><em> </em><em>answers</em><em> </em><em>your question</em><em>.</em><em>.</em><em> </em><em>And</em><em> </em><em>good</em><em> </em><em>luck</em><em>!</em><em> </em>

6 0
3 years ago
Read 2 more answers
Identify the structures of the four____ found in living
jonny [76]

Answer:

Organic Molecules

Explanation:

8 0
3 years ago
Which is a factor that could interrupt the progress of succession?
Sindrei [870]
The answer is
 D. another natural disturbance 
7 0
3 years ago
Read 2 more answers
Other questions:
  • Large mats of green algae lived during the __________ period, more than 550 million years ago .
    12·2 answers
  • Sergei Winogradsky Choose one: A. discovered microbial fermentation. B. developed a pure culturing system using agar. C. identif
    11·2 answers
  • Propose some possible explanations for the large volume of noncoding DNA in the human genome.
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How does the circulatory system work at the organ level?
    14·2 answers
  • One main difference between dementia and delirium is that delirium only affects people over the age of 65. Please select the bes
    5·2 answers
  • Which statement is true about the scientific method? It follows one prescribed sequence of steps. It begins and ends with an exp
    13·1 answer
  • What is the main goal of cellular respiration in cells?​
    11·1 answer
  • Which symbol represents a hybrid?<br><br><br> Aa<br><br> dE<br><br> BB<br><br> cc
    13·1 answer
  • Life takes place in populations, and the size of a population can increase, decrease, or remain the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!