Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
The definition of trade off is an exchange where you give up one thing in order to get something else that you also desire. An example of a trade off is when you have to put up with a half hour commute in order to make more money.
Explanation:
Answer:
d
Explanation:
bc theres a chance it could happen
Primary consumers (such as grazers and browsers) of the biological community will put pressure on the primary producers (these are plants) since the primary producers have limited resources (water) to reproduce due to the drought. The primary producers hence become scarce and cause the primary consumers to compete for limited resources. This causes the primary producers to reduce in population. Reduction in their population causes limited resources for secondary consumers and this cascades up the food web to tertiary consumers.
