1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
3 years ago
10

Please help me out here

Biology
1 answer:
baherus [9]3 years ago
7 0
Mostly like option C. (it has more energy ) would be your answer for this question

Good night or day ☺

☺

You might be interested in
If a chromosome is like a book, then a gene is like__?
valentina_108 [34]

Answer:

Answer;

A specific sentence.

If a chromosome is like a book, then a gene is like a specific sentence.

Explanation:

A chromosome is a structure that is made of a chemical known as deoxyribonucleic acid, or DNA as well as protein. Chromosomes are found in the nucleus of cells. Chromosomes contain many genes. A gene is a molecular unit of heredity, it is a segment of DNA that provides the code to construct a protein.

Chromosomes are made from DNA. Genes are short sections of DNA. Genetically identical cells are produced by a type of cell division called mitos

8 0
3 years ago
Read 2 more answers
Which life activity is not vital for the survival of an individual organism
Anestetic [448]
Reproduction, I am pretty sure

Hope this help
5 0
3 years ago
Ok so if this is High school stuff then my school is trippin, im in 7th grade and have harder questions than that...... ∵
Darya [45]

Answer:

people usually put high schools for some reason

Explanation:

like how you're in 7th grade, but listed "in college".

or its just the system doing that

8 0
2 years ago
Read 2 more answers
Why are seeds important?
frez [133]

They contain high protein, starch and oil reserves that help in the early stages of growth and development in a plant.

5 0
3 years ago
Read 2 more answers
Explain why there is a lagging strand (during DNA Replication).
Nadya [2.5K]

there's a lagging strand during DNA replication when the DNA synthesis becomes discontinuous.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What should you do with its contents if you are done using a test tube?
    14·1 answer
  • A woman's ovary is _____ times the size of a single sperm.
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How can a loss of one species affect many other species
    6·1 answer
  • What is the strong tendency to believe that one's own culture is normal, natural, and superior to other cultures called
    9·2 answers
  • Which layers most likely have a pressure, represented in units of GPa, ranging from 75 GPa to 110 GPa? Check all that apply. Out
    11·2 answers
  • Which of the following is not a metamorphic agent? <br>​
    12·1 answer
  • 7. Dual purpose breed of goat-<br>(A) Barbari (B) Jamnapari<br>(C) Marwari (D) Beetul​
    5·1 answer
  • Determine whether the following statement is true or false and why. “Variation caused by the environment is not heritable, so it
    10·1 answer
  • When populations approach their carrying capacity, their resources ________.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!