1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
7

DNA sequencing of an E. coli colony isolated from a nozzle that had biofilm growth of both bacteria shows that conjugation has o

ccurred. However, the transformed strain of E. coli did not express any new proteins. BLAST analysis shows that the gene for the L. monocytogenesprotein is incomplete in E. coli. Sequence comparison shows that E. coli has a truncated version of the gene that begins at nucleotide number 54 and continues to nucleotide 1257, meaning that no start codon is present.
Why would this interfere with transcription or translation?
1.DNA bases are species specific
2. no start codon for translation
3. E. coli DNA polymerase does not recognize an L. monocytogenes gene sequence
4. no promoter region for the transcription to begin at.
Biology
1 answer:
Anastasy [175]3 years ago
7 0

Answer:

<h2>2</h2>

Explanation:

Translation starts when translation machinery encounter  start codon( AUG) in mRNA. tRNA brings amino acids for protein synthesis according the sequence of nucleotide in mRNA, and protein synthesis occurs with the help of ribosomes. If the gene is truncated or their sequence is so changed that there is no start codon, then the translation will never happen.

In this case in E. coli ; sequence comparison result  shows that E. coli has a truncated version of gene, means mutated type  of the gene that begins at nucleotide number 54 and continues to nucleotide 1257, meaning that there is  no start codon is present. So when there is no codon  codon then there is no translation, so it interfere with translation.

You might be interested in
what is the term used to describe the intake of a vitamin or mineral that greatly exceeds the recommended amounts?
mash [69]

Answer:

The term for vitamins intake is calles vitaminosis or Hypervitaminosis. There is not coined name for the excess of minerals, but it toxic, like iron, cooper, among others.

Explanation:

3 0
3 years ago
Drag the tiles to the correct boxes to complete the palrs.
Vikki [24]

Answer:

Clogging engine cooling systems - Bra Mussels

Extinction of bandicoots - Feral Cats

Blocking water boats - Water Hyacinths

Hope this helps :)

6 0
3 years ago
Read 2 more answers
A(n)\ is a system composed of living organisms and their interaction with the surrounding environment, where the main focus is t
vova2212 [387]

Answer:

The correct answer is 4.ecosystem.

Explanation:

An ecosystem is a system, that is, a set of elements that interact with each other, in which such elements are: physical environment, living beings and their interactions (predator-prey, parasite-host, competition, symbiosis, pollination, distribution of seeds , etc.) The interrelation between living beings (competition, parasitism, etc.) occurs through cycles of matter and energy flows on which the functioning of the entire ecosystem depends.

7 0
3 years ago
The cell membrane is made of phospholipids and is selectively permeable, or semipermeable.
kap26 [50]

Answer: Its when you don't know nothing and lose most of your cells and barely know aything p.s IGMME

7 0
3 years ago
Ribosomes use the directions found in dna to make
kolezko [41]

They use the directions found in DNA to make Proteins & Polypeptides.

8 0
3 years ago
Read 2 more answers
Other questions:
  • A student sets up an experiment and wants to see if different amounts of fertilizer affect the growth of basil. They place 4 sep
    12·1 answer
  • SHort answer question
    11·1 answer
  • Males have hemophilia when they are hemizy-gous for a nonfunctional recessive mutant allele of the X-Iinked gene for clotting fa
    12·1 answer
  • What do cells need to live and move
    14·1 answer
  • When the Sun shines directly on an object, the color of the object determines how the
    9·1 answer
  • Which organisms are eukaryotes?<br> animals<br> plants<br> archaea<br> fungi
    6·1 answer
  • The enzyme pepsin is produced in the cells of the stomach but not in the cells of the small intestine. The small intestine produ
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Which of these is NOT a type of local wind?<br> A. Valley<br> B. Glacier<br> C. Mountain<br> D. Sea
    7·1 answer
  • What three identifying features of a chromosome are used to pair homologous chromosomes in a karyotype?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!