1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liq [111]
3 years ago
14

Which of the following is a good reason for why tobacco smoke is considered a carcinogen?

Biology
2 answers:
Fudgin [204]3 years ago
7 0

Ans.

Carcinogens can be defined as a physical and chemical agent that leads to development of cancer (carcinogenesis), such as radiation, toxic chemicals, and tumor-causing viruses due to mutations in genetic material of cells.

Tobacco is considered as a carcinogen as it can cause lung cancer, mouth cancer, and various other types of cancer. Tobacco contains around seventy chemicals, which promote or initiate cancer and make it a potent carcinogen.

Thus, the correct answer is option). 'it causes mutations leading to cancer.'

olga2289 [7]3 years ago
6 0
It caused mutations leading to cancer because carcinogen means "a substance capable of causing cancer' according to the New Oxford American Dictionary
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The organelle is what part of the cell
frozen [14]

Answer:

cell wall

Explanation:

if its not one of the options sorry!

5 0
3 years ago
In eukaryotes , DNA is found in the cytoplasm of the cell
Paladinen [302]
In eukariotes, cells that have a neculeus, the dna is found in the neculeus, not the cytoplasim so that is false... I dunno if that is what u were asking...
5 0
3 years ago
An organism is unicellular, contains chlorophyll, and has a flagellum. to which kingdom does this organism belong?
denis23 [38]
This organism belongs to the Plantae kingdom
8 0
3 years ago
_____ can disrupt cellular homeostasis and can even lead to uncontrolled cell division and form of cancers
Gekata [30.6K]
The correct answer would be carcinogens. Carcinogens can disrupt cellular homeostasis and can even lead to uncontrolled cell division and form of cancers. These are substances that damages the cellular metabolic processes in the body. Carcinogens are found everywhere; it may be in our food, radiation or even some of the ingredients of the things we use daily. 
6 0
3 years ago
Other questions:
  • Into which layer of the uterus does the embryo implant
    10·2 answers
  • -
    6·1 answer
  • Which energy transformation occurs first in a coal-burning power plant.
    10·2 answers
  • The nurse caring for a client with tuberculosis anticipates administering which vitamin with isoniazid (inh) to prevent inh-asso
    15·1 answer
  • what is the difference between the greatest distance and the least distance ridden on one fifth of a mile to one mile
    9·1 answer
  • Yeast cells are recovered from a fermentation broth by using a tubular centrifuge. Sixty percent of the cells are recovered at a
    7·1 answer
  • 16) Which mantle hot spot is correctly matched to its overlying tectonic plate?
    12·1 answer
  • Some fish that live in pitch-dark caves have things that look like eyes but do not see.
    7·1 answer
  • What are new stars that are found in the spiral arms and formed from recycled dead star material known as?
    8·2 answers
  • What happens to the carbon dioxide (CO2) levels of a plant when it does or does not have light?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!