1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LiRa [457]
3 years ago
7

Which of the following sequence of words BEST fits the following sentence? "____ are found on ____, which make(s) up the ____, f

ound in the ____." DNA; chromosomes; cell; nucleus Genes; nucleus; chromosomes; cell Chromosomes; DNA; genes; nucleus Genes, DNA, chromosomes, nucleus
Biology
1 answer:
aalyn [17]3 years ago
8 0
Genes are found on DNA, which make(s) up the chromosomes, found in nucleus. 

:) x
You might be interested in
Which is true of the amount of matter in ecosystems?
inessss [21]

Answer:

I think its c Scientists cannot determine how it changes.

d). It increases over time.

6 0
2 years ago
The chart below shows the inferred evolution of some dinosaurs during three time periods in Earth’s history.
pochemuha

Answer:

camptosaurus

Explanation:

I think it's correct

4 0
2 years ago
help please!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!What is the dew point? A. The time of day when gas condenses. B. The density at whi
Klio2033 [76]

your answer is C. it is temp where water vapours start to condense and forms liquid droplet from vapour condition.

hope it helps. please mark for best answer if you liked it.

4 0
3 years ago
Read 2 more answers
The scatterplots indicate the population of rabbits in the population over time. The y-axis represents the number of rabbits and
soldi70 [24.7K]

Answer:graph a?

Explanation:

edge2020

4 0
2 years ago
Immense characteristics ?
MakcuM [25]

Answer: Sense Of Humor. Good sense of humor is immensely attractive. End of …

Self-confidence. Confidence makes you shine in all fields of your life, but …

Kindness. Who wants to be around mean or rude people? Imagine going on a …

Passion. As the popular internet meme says, “People are prettiest when they …

Explanation: :)

7 0
2 years ago
Other questions:
  • A student is studying mitosis, in which a cell divides to form two cells. Which of these shows the CORRECT mathematical model fo
    8·2 answers
  • A nurse is about to perform a wound irrigation on a client who had a left hemispheric stroke 1 year ago. which assessment is mos
    12·1 answer
  • What is the limiting factor for the growth of trees in the tundra? question 1 options:
    5·1 answer
  • Describe how surface currents in gyres redistribute heat between the equator and the poles.
    14·1 answer
  • The area of the lower limb that refers to the posterior side of the knee is the __________ region.
    11·1 answer
  • What treatment is being compared to the control in the experiment?
    15·1 answer
  • How are capillaries involved in gas exchange
    13·1 answer
  • Bacterial strain A (met , his-, arg ) is mixed with bacterial strain B (met-, his , arg-), grown in complete media, then plated
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What food is made from the same mold as penicillin?.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!