1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
7

What did Watson and Crick’s model of DNA show?

Biology
2 answers:
mojhsa [17]3 years ago
7 0

A is most definitely the answer

sergejj [24]3 years ago
5 0
Answer
The option A is correct, becuse their model shiw tha DNA is composed of two double strand of nucleotide which are twisted around each other and run in antiparallel direction. the phisphate group and pentose sugar are present on outside, while nitrogenous base is present on inside.
You might be interested in
A species is a group of similar organisms that
Pavel [41]

Answer:  <u>can be with one another to produce fertile offspring. </u>

Explanation: Individuals of the same species can reproduce to make more individuals of the same species.

8 0
3 years ago
Select all that apply. Factors that can increase mutation rates are _____. high temperatureslow temperaturesfood additivesUV ray
Artemon [7]
<span>Factors that can increase mutation rates are high and low temperatures, food additives, and UV rays. All of these answers are correct. Mutation rates in genes vary depending on many environmental effects. UV rays, along with varying temperatures, can cause mutations during cell division due to the damage they impart on the cells that are dividing. Dangerous food additives are believed to cause mutations, as seen in animal studies (ie. aspartame causing cancer in rats).</span>
4 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
What are two consequences of spraying insecticides to get rid of mosquitos? PLEASE ANSWER QUICK
Vera_Pavlovna [14]

Answer:

Pesticides used in mosquito control can contribute to immune suppression in humans. A report from the World Resources Institute notes, "Impairment of the immune system by chemical pesticides can lead to allergies, auto immune disorders such as lupus, and cancer.

Explanation:

6 0
3 years ago
Von willebrand disease is characterized on the basis of the pattern of inheritance. which type of the disease is an autosomal do
Liono4ka [1.6K]
.Alzheimer's disease
7 0
3 years ago
Other questions:
  • Why would a compound that interferes with bacterial cell wall synthesis be useful for treating a bacterial infection?
    6·1 answer
  • Select the five cellular organelles that are part of the endomembrane system.
    10·1 answer
  • The scientific study of heredity is called fertilization
    9·2 answers
  • Which of the following properties of life is likely NOT to be a common
    9·2 answers
  • 3. Which group of organelles is directly responsible for the production of new
    6·1 answer
  • Which of the following glands are holocrineglands?
    6·1 answer
  • Which of the following is a system of organs that collects oxygen from the external environment and transports it to the bloodst
    11·1 answer
  • If Earth did not rotate on its axis...
    9·1 answer
  • Are there more solids or gases?
    10·1 answer
  • Biology &amp; Behavior: Evolution &amp; Genetics<br> Why people behave the way they do?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!