1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oxana [17]
3 years ago
6

Please help me asap really need help thank you

Biology
1 answer:
blsea [12.9K]3 years ago
4 0
I’m pretty sure the answer for ur problem is B
You might be interested in
After mRNA is produced in the nucleus where does it go ?
LekaFEV [45]
<span>it leaves the nucleus, goes to the cytoplasm, binds to a ribosome to be read.</span>
4 0
3 years ago
The carrying capacity is
nika2105 [10]

Answer:

2

Explanation:

i guessed

4 0
3 years ago
Describe some of the ways in which real-world pateontology is different from how it is presented in movies
garik1379 [7]

Answer:

Paleontology in the real world isn't as careless and usually in movies they mis-label things. Paleontology isn't as simple as it seems and in many movies they portray little effort or processing and handling of the fossils. It requires much attention and you have to take care of the bones. Jurassic Park is a great example of fake paleontology and comparing it to real paleontology can surprise you.

Explanation:

7 0
2 years ago
How is dna passed to new cells during cell division?
lesya692 [45]
In mitosis (regular cell division)
the cell (mother cell) duplicates it's DNA and aligns it down the center of the cell, so that when it splits each new cell (daughter cell) gets the exact DNA as the mother cell
8 0
3 years ago
Which of the following factors limits the effectiveness of the Treaty on Plant Genetic Resources?
Debora [2.8K]

A it does not address the loss of biodiversity

8 0
3 years ago
Read 2 more answers
Other questions:
  • How does a nucleus perform its function?*Please explain in a way kids can understand *
    14·1 answer
  • John collected a sample of pond water to look for tiny living microorganisms. Which type of microscope does John need to use to
    9·1 answer
  • Which male accessory structure is inferior to the urinary bladder and surrounds the superior portion of the male urethra?
    6·1 answer
  • Place the living systems in order from smallest to largest based on hierarchical organization.
    9·1 answer
  • The first line of medical care in great britain is the:
    9·1 answer
  • During the systole phase of the cardiac cycle, the left ventricle contracts and blood is pumped into the aorta. Which of these v
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A population of deer is separated by an emerging volcano. The two populations come back into contact 200 years later, but are in
    10·2 answers
  • 13C and 14C are isotopes of 12C, which has 6 electrons, 6 protons, and 6 neutrons. What is the arrangement of subatomic particle
    7·2 answers
  • Why are small leaves an adaptation in a desert environment?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!