1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zavuch27 [327]
3 years ago
9

you are hiking in yosemite, and you notice there are very small plants growing on the rocks next to a waterfall. you wonder what

they are, and some fellow hikers tell you the plants are moss. from information given in the discussion section, what category of plant are they? explain your decision
Biology
1 answer:
gtnhenbr [62]3 years ago
7 0
They are a fungi that harvest energy from what they are attached to and can collect the water from the water fall
You might be interested in
Are centrioles always there? or do they only exist during mitosis
Amiraneli [1.4K]

Answer:yes they do

LOLOLOLOLOL

3 0
3 years ago
What fights invaders of your body​
yarga [219]

White blood cells ( lymphocytes is correct though)

4 0
3 years ago
Read 2 more answers
The important research areas to pursue in microbiology. <br><br>​
ira [324]
Laboratory technician,research associate,laboratory manager,research scientist, lead scientist and-principal investigator
7 0
3 years ago
Which of the following scientists played a part in forming cell theory? (Choose all that apply)
DiKsa [7]

Answer:

theoder schwann and Rudolph Virchow

6 0
1 year ago
Read 2 more answers
How amino acids form proteins?
ioda

<span>Within a protein, multiple amino acids are linked together by peptide bonds, thereby forming a long chain. Peptide bonds are formed by a biochemical reaction that extracts a water molecule as it joins the amino group of one amino acid to the carboxyl group of a neighboring amino acid. </span>

I know DNA and stuff is super hard to learn I had to look at my old notes.

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which is an inference?
    9·1 answer
  • A process that increases genetic diversity during meiosis is called
    14·1 answer
  • Fats supply the body with _________ calories of energy per gram.
    8·1 answer
  • Which of the following pairs of base sequences could form a short stretch of a normal double helix of DNA?
    9·1 answer
  • What is one purpose for the peer-review process in scientific research?
    6·1 answer
  • A community needs more electrical energy. The community is located in an
    9·2 answers
  • Abril.meedina comenta
    11·2 answers
  • What is Photosynthesis?​
    11·2 answers
  • Why do rna viruses appear to have higher rates of mutation?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!