1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
7

Humus is made of tiny pieces of weathered parent material. true or false?

Biology
1 answer:
SSSSS [86.1K]3 years ago
4 0
I believe the answer is false
Humus is made of decomposed, yet organic material
You might be interested in
As compared to developing countries, developed countries have a
kherson [118]
I would say C! Most developing countries have high birth and death rates, while developed countries are more steady.
7 0
3 years ago
The plasma membranes of some plant cells use transport proteins to move protons out of the cell against their concentration grad
Sergio039 [100]
This is an example of active transport
7 0
3 years ago
Because solid objects havevery little energy
vagabundo [1.1K]
The particles are locked in space. they are compactly arranged.
7 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Write the entire name of dna
PilotLPTM [1.2K]

deoxyribonucleic acid

4 0
3 years ago
Read 2 more answers
Other questions:
  • How could the duplication of the Hox gene complex help facilitate animal adaptive radiation?
    7·1 answer
  • HOW MANY CHROMOSOME PAIRS ARE THERE
    7·1 answer
  • How many days passed between the minimum and maximum of the title range in any given area
    13·1 answer
  • Anyone know #1? Thanks!
    15·1 answer
  • Principal types of crime in United States include ...
    6·2 answers
  • What is the purpose of plants having mitochondria if they have chloroplasts?
    5·1 answer
  • What is paleomagnetism and discuss the process in detail.
    12·2 answers
  • 1
    6·2 answers
  • Which is the one reason scientists produce transgenic organisms?
    6·2 answers
  • A particular organism has the following characteristics:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!