1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
13

Question 13 please, proton proton chain reaction is?

Biology
1 answer:
FinnZ [79.3K]3 years ago
7 0

Answer:

It is one of two known sets of nuclear fusion reactions by which stars convert hydrogen to helium.

Explanation:

You might be interested in
Second question please
Rashid [163]
Its bc plants can only take in so much nitrogen like compounds (nitrates, ammonium etc) to keep a stable ph level so ammonium is positively charged and nitrates are negatively charged they release hydrogen to equal the ph levels but since it’s already getting ammonium in the cycle it can’t receive more and the ratio must be compatible with the plants therefore not different.
Also, plants can’t take it in bc it needs the bacteria to break the ammonium down into a usable compound. Like nitrates.
I’m sorry if that was contradicting. I’m trying my best. :)
7 0
3 years ago
Helpppppp !!!!!!!!!!​
NISA [10]

Answer: the first answer is correct.

Explanation:

6 0
3 years ago
How can a person prepare his or her body for an adventure to an extreme environment?
Ksivusya [100]
<span>The person can prepare by eating the right food, exercise, hydration of self and condition oneself for the incoming adventure like extreme.  And also the human body systems respond to changes in the external environment, the nervous system and hormones enable us to respond to external changes. </span>
6 0
3 years ago
Read 2 more answers
A 5 km by 5 km plot has a weed count of 250 weeds. What would the population density be for the exact same plot six months later
Rasek [7]

So 200/25 is equal to 8, and because of that, the plot has 8 weeds per square kilometer.

6 0
3 years ago
Explain intelligence.
Naily [24]

B. The ability to respond to the environment good decision

5 0
3 years ago
Other questions:
  • Snails and insects belong to which group of organisms?
    7·1 answer
  • 5. Describe: How did Earth's oceans form?
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following best completes the hypothesis?
    11·2 answers
  • Explain why predators and prey with many generations of interactions are likely to have pronounced behavioral responses to each
    15·1 answer
  • Question 1
    9·1 answer
  • What did President Kennedy order in response to the missile buildup in Cuba?
    15·1 answer
  • What effect does acid rain have on the environment?.
    8·1 answer
  • Can body hair area be determined how and why
    6·2 answers
  • Evaluation of the pelvis in the rapid trauma assessment includes pressing on the symphysis pubis in which direction?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!