1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
6

How does the moon look

Biology
2 answers:
lesya692 [45]3 years ago
7 0

Answer: if i can get brainliest that would be great

The images of the Moon show what you see the Moon look like from Earth when it is at given points in its orbit. It does not show which side of the Moon is lit by the Sun. ... We only see the Moon because sunlight reflects back to us from its surface. During the course of a month, the Moon circles once around the Earth.

Mashutka [201]3 years ago
5 0
The moon looks very cratered because of all of the asteroids and debris that fell from space during the making of the Earth
You might be interested in
Which of the following is part of the cell theory?
Ivenika [448]

Answer:

cells are the smallest unit of life

Explanation:

5 0
3 years ago
An atom of element A has 64 protons. What would the element's atomic number be?
Lera25 [3.4K]
Protons are equal to atomic number. Meaning the answer would be 64.
6 0
3 years ago
Which of the following is NOT a mental health professional?
mote1985 [20]
B. Radiologist 
Happy to help :) 
8 0
3 years ago
Read 2 more answers
HELP FAST
Burka [1]
I think the answer is D.
5 0
3 years ago
Read 2 more answers
12. Scientists discover a new species of mouse and want to classily it accurately,
Fiesta28 [93]

Answer:

A

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • The first organism in a food chain is a what type of organism?
    8·2 answers
  • A gardener grows Asters, a long-day plant, in his greenhouse. This plant grows well in summer. Which method will help ensure tha
    9·2 answers
  • When an individual receives an organ transplant, explain why they receive special drugs and WHY these drugs often cause the pati
    15·1 answer
  • Which of these is a heterotroph?
    13·2 answers
  • A decrease in GFR will cause __________.
    13·1 answer
  • What way does the glucose go?
    15·2 answers
  • 1. Which is not a part of the respiratory system? Alveoli, Lungs, Trachea, <br> Esophagus ​
    8·1 answer
  • #1 Why would one species of macroinvertebrate be more sensitive to pollution
    15·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Biology question: first correct answer gets Brainly crown
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!