1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sammy [17]
3 years ago
9

A microbiologist wants to study the virus particles from a urine sample, but not any bacteria that might be present. How can the

bacteria be eliminated without harming the viruses
Biology
1 answer:
ahrayia [7]3 years ago
8 0
D a chemostat using a low-nutrient medium
You might be interested in
7. What are C4 and CAM plants? What is their significance?
alex41 [277]

Answer:

C3, C4 and CAM are the three different processes that plants use to fix carbon during the process of photosynthesis. Fixing carbon is the way plants remove the carbon from atmospheric carbon dioxide and turn it into organic molecules like carbohydrates.

Explanation:

Download docx
3 0
2 years ago
What determines the similarity in anatomical features among organisms
KiRa [710]
Homologies. These determine if there are any similarities. Such as the wings on a butterfly to a bird.  
5 0
3 years ago
Read 2 more answers
I give you brilliant
Alekssandra [29.7K]

Answer:

As soon as the concentration passed 39, the plants died. Adding to that, I have also found out that the lower the concentration of the sugar, the  more the average height becomes.

Explanation:

Plant growth and development are tightly controlled in response to environmental conditions that influence the availability of photosynthetic carbon in the form of sucrose. Trehalose-6-phosphate (T6P), the precursor of trehalas in the biosynthetic pathway, is an important signalling metabolite that is involved in the regulation of plant growth and development in response to carbon availability. In addition to the plant’s own pathway for trehalas synthesis, formation of T6P or trehalas by pathogens can result in the reprogramming of plant metabolism and development. Developmental processes that are regulated by T6P range from embryo development to leaf senescence. Some of these processes are regulated in interaction with phytohormones, such as auxin. A key interacting factor of T6P signalling in response to the environment is the protein kinase sucrose non-fermenting related kinase-1 (SnRK1), whose catalytic activity is inhibited by T6P. SnRK1 is most likely involved in the adjustment of metabolism and growth in response to starvation. The transcription factor bZIP11 has recently been identified as a new player in the T6P/SnRK1 regulatory pathway. By inhibiting SnRK1, T6P promotes biosynthetic reactions. This regulation has important consequences for crop production, for example, in the developing wheat grain and during the growth of potato tubers.

8 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
What biome receives the least rainfall
Ulleksa [173]

Answer:

deserts

Desert biomes are the driest of all the biomes. In fact, the most important characteristic of a desert is that it receives very little rainfall. Most deserts receive less than 300 mm a year compared to rainforests, which receive over 2,000 mm.

Explanation:

8 0
3 years ago
Other questions:
  • A lichen is actually composed of two organisms: a fungi and a blue-green algae. Both organisms benefit from this relationship. W
    8·2 answers
  • 3. Which of the following statements regarding DNA is false?
    9·1 answer
  • A client with a diagnosis of colon cancer has opted for a treatment plan that will include several rounds of chemotherapy. what
    8·1 answer
  • How many DNA molecules would there be after 4 DNA molecules unzip and replicate ? 4 or 8
    9·2 answers
  • Compunds are made up of ______ ? <br><br> 1. Electrons<br> 2. Cells<br> 3. Protons<br> 4. Molecules
    11·2 answers
  • The nurse is caring for a bedridden patient. during the physical examination, the nurse observes that the patient has intact, no
    11·1 answer
  • Label the diagram below. Use these choices: Metaphase 1, Metaphase 2, Interphase, Telophase 1, Telophase 2, Anaphase 1, Anaphase
    8·1 answer
  • Marshes are generally flooded for most of the year. Which types of plant live here?
    14·2 answers
  • what kingdom is the spongy parenchyma cell in? describe the features of this kingdom. what are 2 other organisms that are in thi
    13·1 answer
  • The organisms in the diagram below represent an energy pyramid. Which of the following best explains why the number of organisms
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!