1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
11

6.

Biology
1 answer:
DENIUS [597]3 years ago
7 0

Answer: the answer is D. All of the above

Explanation:

Seperation technique is used to separate undisolved solid particle from liquid.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Bats have oversized ears, which helps the bats use sound waves to detect the motion of their prey. Which example of the characte
lesantik [10]

Answer:

echolocation

it sends waves for them to see around them.

Explanation:

3 0
2 years ago
Read 2 more answers
Wats da answer bc I’m confused
trapecia [35]

Answer:

A. Cell

B. Organ

C. Tissue

Explanation:

cell: The smallest unit of life capable of independent reproduction. Generally contains nucleic acid, cytoplasm, a cell membrane, and many other proteins and structures.

organ: A structure made of different tissues that work together to perform physiological functions.

Tissues: A group of similar cells with the same origin that work together to perform the same function.

3 0
2 years ago
(06.01 MC)
garri49 [273]

Answer:

It was discovered that the organisms in each of the five kingdoms have a different method of obtaining nutrients and are therefore fundamentally different.

Explanation:

New kingdoms were needed that reflected our growing knowledge of the differences between living organisms.

7 0
3 years ago
The best way to reduce wind erosion on a farm is to
kiruha [24]

The best way to reduce wind erosion on farm is to plant ground cover in unused fields.

Explanation:

  • Wind erosion is defined as the removal of the top soil from unused barren land by winds.
  • This results in degradation in the soil fertility and renders it unproductive.
  • Roots of plants bind soil particles.
  • Planting ground covers like herbs , shrubs and wild plants on unused land will prevent the exposure of the top soil to the eroding agents and reduce erosion.

6 0
3 years ago
Other questions:
  • Which of the following would most likely incense the rate of photosynthesis?
    11·1 answer
  • The major role of the respiratory system is to __________.
    15·1 answer
  • How does genetic diversity affect biodiversity in an area provide an example
    10·1 answer
  • Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology
    6·2 answers
  • Somatic cancer cells often are unstable and divide inappropriately (divide when they should not be dividing). In addition such c
    10·2 answers
  • What is energy? Where does energy come from? Where does electrical power come from? How is it generated? 4. Why do we need energ
    8·1 answer
  • Some unusual bacteria called blue-green bacteria are able to make their own food. Blue-green bacteria contain the green substanc
    9·1 answer
  • Can a codon contain two of the same nucleotide bases?
    14·2 answers
  • What occurs during the mitosis stage of the cell cycle?
    13·1 answer
  • Describe the chemistry of two types of enzymes and explain how the apoenzyme forms.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!